Suppression of kinesin expression in cultured hippocampal neurons using antisense oligonucleotides.

Abstract

. Kinesin, a microtubule-based forcegenerating molecule, is thought to translocate organelles along microtubules. To examine the function of kinesin in neurons, we sought to suppress kinesin heavy chain (KHC) expression in cultured hippocampal neurons using antisense oligonucleotides and study the phenotype of these KHC "null" cells. Two different antisense oligonucleotides complementary to the KHC sequence reduced the protein levels of the heavy chain by greater than 95% within 24 h after application and produced identical phenotypes . After inhibition of KHC expression for 24 or 48 h, neurons extended an array of neurites often with one neurite longer than the others ; however, the length of all these neurites was significantly reduced . Inhibition of KHC expression also altered the distribution of GAP-43 and synapsin I, two proteins thought to be transported in astNESIN, a microtubule-based motor protein, is a heterotetramer consisting of two 110-130 kD heavy chains and two 60-70 kD light chains (Bloom et al ., 1988 ;Kuznetsov et al., 1988) . The primary structure of the heavy chain is conserved in four widely divergent species : Drosophila (Yang et al ., 1989), squid (Kosik et al ., 1990), sea urchin (Wright et al., 1991), and human (Navone et al ., in press) . Purified kinesin generates ATP-dependent microtubule gliding after being adsorbed onto glass coverslips (Vale et al., 1985a ;Scholey et al., 1985 ;Porter et al ., 1987) or induces the transport of latex beads along microtubules after adsorption onto the bead surface (Vale et al ., 1985a). In experiments with purified bovine chromaffin granules, the addition of kinesin and ATP was sufficient to induce translocation ofthe granules along microtubules (Urrutia et al ., 1991) . Kinesin-coated objects move unidirectionally towards the plus end of microtubules (Vale et al ., 1985b ;Porter et al ., 1987). This direction corresponds to anterograde transport in neurons, since axonal microtubules have their plus ends oriented distally (Filliatreau and sociation with membranous organelles. These proteins, which are normally localized at the tips of growing neurites, were confined to the cell body in antisensetreated cells. Treatment of the cells with the corresponding sense oligonucleotides affected neither the distribution of GAP-43 and synapsin I, nor the length of neurites . A full recovery of neurite length occurred after removal of the antisense oligonucleotides from the medium . These data indicate that KHC plays a role in the anterograde translocation of vesicles containing GAP-43 and synapsin I. A deficiency in vesicle delivery may also explain the inhibition of neurite outgrowth . Despite the inhibition of KHC and the failure of GAP43 and synapsin I to move out of the cell body, hippocampal neurons can extend processes and acquire an asymmetric morphology.

Axonal Membrane Proteins Are Transported in Distinct Carriers: A Two-Color Video Microscopy Study in Cultured Hippocampal Neurons

“…Five to 6 h later transfection oligos were added at a concentration of 0.5 M. Twelve hours later oligos were added at a concentration of 0.25 M. Video microscopy was performed 26 -28 h after transfection. Treating cells with oligos at 50 M (Ferreira et al, 1992) led to similar results, except that even more structures changed direction of movement (our unpublished results).…”

“…Oligonucleotides used were GCCGGGTCCGC-CATCTTTCTGGCAG, the inverse complement of the rat nucleotides Ϫ11 to ϩ 14 of conventional kinesin heavy chain (KHC), and CTGCCAGAAAGATGGCGGACCCGGC, the corresponding sense oligonucleotide (Ferreira et al, 1992). Five to 6 h later transfection oligos were added at a concentration of 0.5 M. Twelve hours later oligos were added at a concentration of 0.25 M. Video microscopy was performed 26 -28 h after transfection.…”

“…Antisense experiments were done as previously described by Ferreira et al (1992). Oligonucleotides used were GCCGGGTCCGC-CATCTTTCTGGCAG, the inverse complement of the rat nucleotides Ϫ11 to ϩ 14 of conventional kinesin heavy chain (KHC), and CTGCCAGAAAGATGGCGGACCCGGC, the corresponding sense oligonucleotide (Ferreira et al, 1992).…”

Microtubule-dependent control of cell shape and pseudopodial activity is inhibited by the antibody to kinesin motor domain.

“…However, we should stress that it does not necessarily mean that microtubule motors are not involved in neurite elongation in PC12 cells. For example, Ferreira et al (1992) showed that antisense nucleotides to kinesin heavy chain inhibited neurite elongation in cultures of rat hippocampal neurons. If this is the case for PC12 cells as well, it is possible that some other member of kinesin superfamily rather than kinesin per se is involved in generation of neuronal polarity and this member probably is not inhibited by our antibody.…”

Clonal Tests of Conventional Kinesin Function during Cell Proliferation and Differentiation

“…Conversely, antisense oligonucleotide inhibition of KHC in cultured rat astrocytes (Feiguin et al, 1994) and gene disruption in cultured mouse extraembryonic cells (Tanaka et al, 1998) did not prevent brefeldin A-induced Golgi-to-ER membrane transfer. With regard to Golgi-to-plasma membrane vesicle transport, antisense oligonucleotide inhibition of KHC in cultured vertebrate neurons impaired delivery of vesicles containing certain synaptic proteins to axon terminals (Ferreira et al, 1992). In contrast, Khc mutations in Drosophila and Caenorhabditis elegans did not prevent the accumulation of normal levels of synaptic vesicles at axon terminals (Hall et al, 1991;Gho et al, 1992).…”