Suppressing Glucose Transporter Gene Expression in Schistosomes Impairs Parasite Feeding and Decreases Survival in the Mammalian Host

Abstract

Adult schistosomes live in the host's bloodstream where they import nutrients such as glucose across their body surface (the tegument). The parasite tegument is an unusual structure since it is enclosed not by the typical one but by two closely apposed lipid bilayers. Within the tegument two glucose importing proteins have been identified; these are schistosome glucose transporter (SGTP) 1 and 4. SGTP4 is present in the host interactive, apical tegumental membranes, while SGTP1 is found in the tegumental basal membrane (as well as in internal tissues). The SGTPs act by facilitated diffusion. To examine the importance of these proteins for the parasites, RNAi was employed to knock down expression of both SGTP genes in the schistosomula and adult worm life stages. Both qRT-PCR and western blotting analysis confirmed successful gene suppression. It was found that SGTP1 or SGTP4-suppressed parasites exhibit an impaired ability to import glucose compared to control worms. In addition, parasites with both SGTP1 and SGTP4 simultaneously suppressed showed a further reduction in capacity to import glucose compared to parasites with a single suppressed SGTP gene. Despite this debility, all suppressed parasites exhibited no phenotypic distinction compared to controls when cultured in rich medium. Following prolonged incubation in glucose-depleted medium however, significantly fewer SGTP-suppressed parasites survived. Finally, SGTP-suppressed parasites showed decreased viability in vivo following infection of experimental animals. These findings provide direct evidence for the importance of SGTP1 and SGTP4 for schistosomes in importing exogenous glucose and show that these proteins are important for normal parasite development in the mammalian host.

Tegumental Phosphodiesterase SmNPP-5 Is a Virulence Factor for Schistosomes

“…However, we and other groups have shown an impact of gene suppression in schistosomes by introducing parasites immediately after RNAi treatment (i.e., using protocol 1) (12,19,24). This apparent discrepancy may be due to differences in the ability of parasites to recover from suppression of different gene targets and/or due to the higher susceptibility of schistosomula to a diminution of a particular target gene product during the initial phase of infection.…”

“…In order to test the effects of knocking down expression of the SmNPP-5 gene in vivo, we first followed a protocol in which schistosomula were used to infect mice immediately after siRNA treatment (12,19,24,32). Using this method (which we designate "protocol 1"), no differences in worm burden in the test versus control groups were found after 28 days and no obvious morphological differences between the recovered worms from the different groups were seen.…”

“…One-day-old cultured schistosomula were electroporated with either SmNPP-5, or control or no siRNA. Some parasites were then used to infect female Swiss Webster mice by adding ϳ1,000 schistosomula to 100 l of RPMI medium without phenol red and injecting the inoculum into the thigh muscle of the animals using a 1-ml tuberculin syringe and a 25-gauge, 1-in needle (19). The remaining parasites were cultured in vitro to allow an assessment of gene suppression levels at different time points.…”

Lactate as a Novel Quantitative Measure of Viability in Schistosoma mansoni Drug Sensitivity Assays

“…Adult parasites consume large amounts of glucose and every 5 h consume an amount of glucose equal to their dry weight (21). In both adult and larval-stage Schistosoma parasites, glucose is transported from the host bloodstream across the parasite outer surface, the tegument, via the specific parasite glucose transporters SGTP1 and SGTP4 (22). The breakdown of glucose via glycolysis mainly results in lactate, which is excreted via the aquaglyceroporin homologue SmAQP, located in the tegument of adult worms and schistosomula (23,24).…”

Schistosome apyrase SmATPDase1, but not SmATPDase2, hydrolyses exogenous ATP and ADP

“…To detect SmATPDase2, the following primers and probe were used: SmATPDase2 forward; 5′ GGTTATGGATTCCCGGCAGA TA 3′, SmATPDase2 reverse; 5′-TGAAAATAAGGCACCA AGACTCCAA-3′, SmATPDase2 probe; 5′-FAM-TTGGAT TTTTTAGAAAAGTTAATTCT-3′. Alpha tubulin was used as the endogenous control gene for relative quantification, as described [25], employing the ΔΔCt method [26]. Results obtained from parasites treated with irrelevant siRNA were used for calibration.…”