Sumoylation of Pdx1 is associated with its nuclear localization and insulin gene activation

Kishi, Akio; Nakamura, Takaaki; Nishio, Yoshihiko; Maegawa, Hiroshi; Kashiwagi, Atsunori

doi:10.1152/ajpendo.00390.2002

Cited by 88 publications

(64 citation statements)

References 56 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Such a mechanism has been shown for nuclear translocation of the insulin gene regulator Pdx1 as well as the tumor suppressor Smad4 (29)(30)(31). We show here that SENP1 overexpression in the nucleus of RASF led further to the specific accumulation of HDAC4 on the DNA.…”

Section: Overexpression Of Senp1 Leads To An Accumulation Of Histone supporting

confidence: 68%

Epigenetics and rheumatoid arthritis: The role of SENP1 in the regulation of MMP-1 expression

Maciejewska-Rodrigues¹,

Karouzakis²,

Strietholt³

et al. 2010

Journal of Autoimmunity

View full text Add to dashboard Cite

The aggressive phenotype of RA synovial fibroblasts (RASF) is characterised by the increased expression of matrix metalloproteinase (MMP)-1 as well as the small ubiquitin like modifier (SUMO)-1 and decreased expression of SUMO-specific protease SENP1. Since we showed an increased activity of acetyltransferases in this autoimmune disease, we wanted to analyse whether this affects the expression of MMP-1 and can be reversed by the reconstitution of SENP1.In RASF, the acetylation of histone H4 was significantly increased in the distal region of the MMP-1 promoter by 274 ± 36% compared to OASF. Most interestingly, overexpression of SENP1 in RASF decreased acetylation specifically in this region by 51 ± 0.5% and globally by 73 ± 11%. Furthermore, the overexpression of SENP1 resulted in a downregulation of MMP-1 at both the mRNA (58  7%) and protein levels (28 ± 6%), significantly reduced the invasiveness of RASF (from 34  9% to 2  2%) and led to an accumulation of histone deacetylase 4 (HDAC4) on the MMP-1 promoter (197 ± 36%). Interestingly, SENP1 failed to modulate the expression of MMP-1 in the cells silenced for HDAC4. This is the first study linking the SUMOylation pathway and the production of MMP-1 to an epigenetic control mechanism mediated through histone acetylation which has a functional consequence for the invasiveness of RASF.

show abstract

Section: Overexpression Of Senp1 Leads To An Accumulation Of Histone supporting

confidence: 68%

Epigenetics and rheumatoid arthritis: The role of SENP1 in the regulation of MMP-1 expression

Maciejewska-Rodrigues¹,

Karouzakis²,

Strietholt³

et al. 2010

Journal of Autoimmunity

View full text Add to dashboard Cite

show abstract

“…Control siRNAs against GAPGH (siGAPDH) and SUMO-1 (siSUMO-1) were also generated. The siRNA target sequence for SUMO-1 (AAGGTGAATATATTAAACTCA) was from Akio Kishi et al (23). The siRNA templates for GAPDH were provided in the construction kit.…”

Section: Methodsmentioning

confidence: 99%

A Gene Expression Signature for Relapse of Primary Wilms Tumors

Kessler

Yeger

et al. 2005

Cancer Research

View full text Add to dashboard Cite

Anaplastic histology and metastasis are each associated with higher relapse and mortality rates in Wilms tumor patients. However, not all anaplastic tumors relapse and some nonanaplastic tumors relapse unexpectedly. To identify more accurate early prognostic indicators, we analyzed expression of 4,900 cancer-related genes in 26 primary Wilms tumors. This analysis revealed that expression of a set of four genes predicts future relapse of primary Wilms tumors with high accuracy, independent of anaplasia. Random permutation testing of this prognostic gene expression signature yielded P = = = 0.003. Real-time reverse transcription-PCR analysis of the four genes in an independent primary tumor set resulted in correct prediction of future relapse with an accuracy of 92%. One of the four genes in the prognostic signature, CCAAT/ /enhancer binding protein h h (C/ /EBPB), is expressed at higher levels in both primary relapsing tumors and metastatic tumors than in primary nonrelapsing tumors. Short interfering RNA-mediated down-regulation of C/ / /EBPB expression in WiT49, a cell line derived from a metastatic Wilms tumor, resulted in spontaneous apoptosis. These findings suggest that C/ / /EBPB is a critical survival factor for Wilms tumor cells and that its expression contributes to the prognosis of Wilms tumor patients. (Cancer Res 2005; 65(7): 2592-601)

show abstract

“…nuclear-cytoplasmic shuttling) or function would allow for acute alterations to target gene transcription, where control on the order of seconds to minutes might be crucial. At least 3 different reversible post-translational modifications, including phosphorylation [86,108,[110][111][112][113][114], sumoylation [115], and glycosylation [116], have been proposed to explain nuclearcytoplasmic shuttling and/or other functions of Pdx1. Consistent with these modifications, different molecular weight species of Pdx1 have been described in immunoblots [115].…”

Section: Mechanism Of Pdx1 Action Posttranslational Modifications Of mentioning

confidence: 99%

A feat of metabolic proportions: Pdx1 orchestrates islet development and function in the maintenance of glucose homeostasis

Babu

Deering

Mirmira

2007

Molecular Genetics and Metabolism

View full text Add to dashboard Cite

Emerging evidence over the past decade indicates a central role for transcription factors in the embryonic development of pancreatic islets and the consequent maintenance of normal glucose homeostasis. Pancreatic and duodenal homeobox 1 (Pdx1) is the best studied and perhaps most important of these factors. Whereas deletion or inactivating mutations of the Pdx1 gene causes whole pancreas agenesis in both mice and humans, even haploinsufficiency of the gene or alterations in its expression in mature islet cells causes substantial impairments in glucose tolerance and the development of a late-onset form of diabetes known as maturity onset diabetes of the young. The study of Pdx1 has revealed crucial phenotypic interrelationships of the varied cell types within the pancreas, particularly as these impinge upon cellular differentiation in the embryo and neogenesis and regeneration in the adult. In this review, we describe the actions of Pdx1 in the developing and mature pancreas and attempt to unify these actions with its known roles in modulating transcriptional complex formation and chromatin structure at the molecular genetic level.

show abstract

Sumoylation of Pdx1 is associated with its nuclear localization and insulin gene activation

Cited by 88 publications

References 56 publications

Epigenetics and rheumatoid arthritis: The role of SENP1 in the regulation of MMP-1 expression

Epigenetics and rheumatoid arthritis: The role of SENP1 in the regulation of MMP-1 expression

A Gene Expression Signature for Relapse of Primary Wilms Tumors

A feat of metabolic proportions: Pdx1 orchestrates islet development and function in the maintenance of glucose homeostasis

Contact Info

Product

Resources

About