SUMOylation and Ubiquitylation Circuitry Controls Pregnane X Receptor Biology in Hepatocytes

Abstract

Several nuclear receptor (NR) superfamily members are known to be the molecular target of either the small ubiquitin-related modifier (SUMO) or ubiquitin-signaling pathways. However, little is currently known regarding how these two post-translational modifications interact to control NR biology. We show that SUMO and ubiquitin circuitry coordinately modifies the pregnane X receptor (PXR, NR1I2) to play a key role in regulating PXR protein stability, transactivation capacity, and transcriptional repression. The SUMOylation and ubiquitylation of PXR is increased in a ligand-and tumor necrosis factor alpha-dependent manner in hepatocytes. The SUMO-E3 ligase enzymes protein inhibitor of activated signal transducer and activator of transcription-1 (STAT1) STAT-1 (PIAS1) and protein inhibitor of activated STAT Y (PIASy) drive high levels of PXR SUMOylation. Expression of protein inhibitor of activated stat 1 selectively increases SUMO(3)ylation as well as PXR-mediated induction of cytochrome P450, family 3, subfamily A and the xenobiotic response.The PIASy-mediated SUMO(1)ylation imparts a transcriptionally repressive function by ameliorating interaction of PXR with coactivator protein peroxisome proliferator-activated receptor gamma coactivator-1-alpha. The SUMO modification of PXR is effectively antagonized by the SUMO protease sentrin protease (SENP) 2, whereas SENP3 and SENP6 proteases are highly active in the removal of SUMO2/3 chains. The PIASy-mediated SUMO(1)ylation of PXR inhibits ubiquitin-mediated degradation of this important liverenriched NR by the 26S proteasome. Our data reveal a working model that delineates the interactive role that these two post-translational modifications play in reconciling PXR-mediated gene activation of the xenobiotic response versus transcriptional repression of the proinflammatory response in hepatocytes. Taken together, our data reveal that the SUMOylation and ubiquitylation of the PXR interface in a fundamental manner directs its biologic function in the liver in response to xenobiotic or inflammatory stress.

Acetylation of lysine 109 modulates pregnane X receptor DNA binding and transcriptional activity

“…In this case, SUMOylation acts in a promoter-specific manner. A recent follow-up study demonstrated that PXR is SUMOylated specifically at K108 [85]. It would be interesting to see how SUMOylation of PXR at K108 and adjacent acetylation at K109 influence one another and whether there is functional importance in this interaction.…”

A SUMO-acetyl switch in PXR biology

“…To generate (His) 6 -PXR-SUMO1 and (His) 6 -PXR-SUMO3 linear fusion construct, we used the following PCR primers that introduce XhoI restriction sites and both adds a STOP codon and removes one C-terminal glycine from the SUMO1 and SUMO3: SUMO1- left primer- 5’ GACGGCCTCGAGGCCATGTCTGACCAGGAGGCAAAA 3’; SUMO1- right primer- 5’ GACGGCCTCGAGCTACCCCGTTTGTTCCTGATAAAC 3’; SUMO3- left primer- 5’ GACGGCCTCGAGCCATGTCCGAGGAGAAGCCCAAG 3’; SUMO3- right primer 5’ GACGGCCTCGAGCTATCCCGTCTGCTgCTGGAACAC 3’. The modified SUMO1 and SUMO3 sequences were amplified and then sub-cloned into pShuttle-(His) 6 -PXR-(FLAG) 3 expression vector using the XhoI restriction site that exists in between the last amino acid of PXR and the triple FLAG tag in this expression vector [11]. The FLAG-SUMO3-PXR construct was generated using the following PCR primers to introduce EcoRI restriction sites and removes the STOP codon and one glycine residue from SUMO3: SUMO3- left primer- 5’ GACGGCGAATTCATGTCCGAGGAGAAGCCCAAG 3’; SUMO3- right primer- 5’ GACGGCGAATTCTCCCGTCTGCTGCTGGAACAC 3’.…”

“…The FLAG-SUMO3-PXR construct was generated using the following PCR primers to introduce EcoRI restriction sites and removes the STOP codon and one glycine residue from SUMO3: SUMO3- left primer- 5’ GACGGCGAATTCATGTCCGAGGAGAAGCCCAAG 3’; SUMO3- right primer- 5’ GACGGCGAATTCTCCCGTCTGCTGCTGGAACAC 3’. The resulting amplimer was digested with EcoRI and inserted into the EcoRI site that exists between the FLAG epitope and PXR in the previously described pCMV-Tag human PXR expression construct [11]. All expression vectors were sequenced on both strands to ensure the integrity of the resulting open-reading frames.…”

“…Our recent efforts combined with that of others indicate that phosphorylation, ubiquitylation, and SUMOylation of PXR play a pivotal and likely interactive role in regulating the biological function of this nuclear receptor protein [11-18]. However, where the PTMs occur on the protein and how they might interact with each other in live cells to regulate its complex biology in liver and intestine is only beginning to be understood.…”

Threonine-408 Regulates the Stability of Human Pregnane X Receptor through Its Phosphorylation and the CHIP/Chaperone-Autophagy Pathway

“…Post-translational modifications to the human PXR (hPXR) by phosphorylation and through small ubiquitin-related modifier-and ubiquitin-signaling pathways have been shown to influence the functions of hPXR by modulating intracellular localization and nuclear activation (Lichti-Kaiser et al, 2009;Pondugula et al, 2009;Staudinger et al, 2011;Sugatani et al, 2012Sugatani et al, , 2014Smutny et al, 2013;Elias et al, 2014;Cui et al, 2015). Cyclin-dependent kinase 2 has been shown to phosphorylate hPXR at serine-350 to suppress the binding with retinoid X receptor by maintaining the acetylation of the hPXR protein, thereby downregulating hPXR activity (Lin et al, 2008;Sugatani et al, 2012).…”