Sulindac, 3,3’-diindolylmethane and curcumin reduce carcinogenesis in the Pirc rat, an Apc-driven model of colon carcinogenesis

Abstract

BackgroundRecently, we showed that Sulindac (SU; 320 ppm) reduces precancerous lesions in the colon of Pirc rats, mutated in the Apc gene. Surprisingly, previous data in Apc-mutated mice showed that SU, with reported efficacy in Familial Adenomatous Polyposis (FAP), increases colon carcinogenesis. Therefore, we assessed the effect of SU 320 ppm in a long-term carcinogenesis experiment in Pirc rats. Moreover, since side effects of SU hamper its chronic use and a combination of drugs could be more effective and less toxic than single agents, we also studied whether two natural compounds, 3,3’-diindolylmethane (DIM; 250 ppm) and curcumin (CUR; 2000 ppm), with or without lower doses of SU could affect carcinogenesisMethodsPirc rats were fed an AIN76 diet containing SU, DIM and CUR and sacrificed at 8 months of age to measure intestinal tumours. Apoptosis and proliferation in the normal colon mucosa, as well as gene expression profile were studiedResultsColon tumours were significantly reduced by SU 320 ppm (62 % reduction over Controls), by DIM and CUR without or with SU 80 and 160 ppm (50, 53 and 58 % reduction, respectively) but not by SU 80 ppm alone. Total tumours (colon and small intestine) were reduced by SU (80 and 320 ppm) and by DIM and CUR. Apoptosis in the normal mucosa was significantly increased by SU 320 ppm, and slightly increased by DIM and CUR with or without SU. A slight reduction in Survivin-Birc5 expression was observed with all the treatments compared to Controls. Proliferative activity was not variedConclusionsThe results on SU reinforce the validity of Pirc rats to identify chemopreventive products. Moreover, the efficacy of the DIM and CUR combination to lower colon tumours, suggests an alternative strategy to be exploited in patients at risk.Electronic supplementary materialThe online version of this article (doi:10.1186/s12885-015-1627-9) contains supplementary material, which is available to authorized users.

Phytosomal curcumin inhibits tumor growth in colitis‐associated colorectal cancer

“…Curcumin (2000 ppm) could affect carcinogenesis since total tumors (colon and small intestine) were reduced by curcumin. Curcumin treatment slightly increased apoptosis in the normal mucosa (Femia et al, ).…”

Gene Expression Profile of Colon Mucosa after Cytotoxic Insult in wt and Apc-Mutated Pirc Rats: Possible Relation to Resistance to Apoptosis during Carcinogenesis

“…Pirc and wt rats were analyzed with procedures previously described [9]. The primers used for the amplification of the different genes were the following: Gsta1 (also known as Gsta3, NM_031509): Fw (5′-3′) GGACAAAGCAAGGAACCGTT, Rv (5′-3′) CAGAGGGAAGTTGGCCAAAG; Gstp1 (NM_012577): Fw (5′-3′) TACTTCATCGTCCACGCAGC, Rv (5′-3′) GGACTTGAGCGAGCCTTGAA; Irf7 (NM_001033691): Fw (5′-3′) CCTCTGCTTTCTGGTGATGC, Rv (5′-3′) GCGCTCAGTCATCAGAACTG; Mgmt (NM_012861): Fw (5′-3′) GCCTATTTCCACGAACCTGC, Rv (5′-3′) CCTCATCGCTCCTCCTACTG; Oas1a (NM_138913): Fw (5′-3′) CTGAAGAGTCTCATCCGCCT, Rv (5′-3′) CCCTGAGCTGTGTTGAACTC; Oasl2 (NM_001009682): Fw (5′-3′) GTGAAAAGTCGCCCGGTTAA, Rv (5′-3′) CTGTACCCATCTCCCAAGCA; Taf6l (NM_001107575) Fw (5′-3′) AGGACTTCAACAGGGCTCTC, Rv (5′-3′) AGACATGAACTCTGACGGCT; Isg15 (NM_001106700) Fw (5′-3′) ATCCTCTGAGCATCCTGGTG, Rv (5′-3′) GTGGGGTGTTAGGCCATACT; Rplp1 (NM_001007604): Fw (5′-3′) TGCTCTCATTAAAGCAGCTGG, Rv (5′-3′) AAAGACCAAAGCCCATGTCA.…”

Oncogenic targets Mmp7, S100a9, Nppb and Aldh1a3 from transcriptome profiling of FAP and Pirc adenomas are downregulated in response to tumor suppression by Clotam

“…Sulindac is highly effective in preclinical models that mimic FAP, including the Apc‐driven mutant polyposis in rat colon (Pirc) . In addition to the presence of a significant colon tumor burden, the Pirc model has a lifespan suitable for both prevention and promotion studies .…”

“…5 Sulindac is highly effective in preclinical models that mimic FAP, including the Apc-driven mutant polyposis in rat colon (Pirc). [8][9][10] In addition to the presence of a significant colon tumor burden, the Pirc model has a lifespan suitable for both prevention and promotion studies. [8][9][10][11] Using a new endoscopic tracking methodology, 12 we evaluated agents that might substitute for Sulindac, and identified Clotam (tolfenamic acid, TA) as a promising candidate in the Pirc model.…”