Succession of transiently active tumor‐initiating cell clones in human pancreatic cancer xenografts

Ball, Claudia R.; Oppel, F.; Ehrenberg, Karl Roland; Dubash, Taronish D.; Dieter, Sebastian M.; Hoffmann, Christopher M.; Abel, Ulrich; Herbst, Friederike; Koch, Moritz; Werner, Jens; Bergmann, Frank; Ishaque, Naveed; Schmidt, Manfred; Kalle, Christof von; Scholl, Claudia; Fröhling, Stefan; Brors, Benedikt; Weichert, Wilko; Weitz, Jürgen; Glimm, Hanno

doi:10.15252/emmm.201607354

Cited by 39 publications

(47 citation statements)

References 62 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…These observations may parallel our previous findings with human WT in which undifferentiated blastema that preserves the embryonic renal progenitor state was expanded in WT-PDX models ( Dekel et al., 2006 , Pode-Shakked et al., 2017 ). Nevertheless, bearing in mind the plasticity of CSC (non-CSC transiting to CSC), the possibility that the experimental setting we have generated may just reflect serial selection of tumor cell populations that adapt to the mouse microenvironment ( Batlle and Clevers, 2017 ) as well as the appearance of successive activation of tumor-initiating cell clones during serial xenotransplantation ( Ball et al., 2017 ), we have designed a series of experiments to test the relevance of our platform. First, the putative CSC-related gene signature set disclosed molecules previously implicated in CSC such as ALDH1.…”

Section: Discussionmentioning

confidence: 99%

In Vivo Expansion of Cancer Stemness Affords Novel Cancer Stem Cell Targets: Malignant Rhabdoid Tumor as an Example

et al. 2018

View full text Add to dashboard Cite

SummaryCancer stem cell (CSC) identification relies on transplantation assays of cell subpopulations sorted from fresh tumor samples. Here, we attempt to bypass limitations of abundant tumor source and predetermined immune selection by in vivo propagating patient-derived xenografts (PDX) from human malignant rhabdoid tumor (MRT), a rare and lethal pediatric neoplasm, to an advanced state in which most cells behave as CSCs. Stemness is then probed by comparative transcriptomics of serial PDXs generating a gene signature of epithelial to mesenchymal transition, invasion/motility, metastasis, and self-renewal, pinpointing putative MRT CSC markers. The relevance of these putative CSC molecules is analyzed by sorting tumorigenic fractions from early-passaged PDX according to one such molecule, deciphering expression in archived primary tumors, and testing the effects of CSC molecule inhibition on MRT growth. Using this platform, we identify ALDH1 and lysyl oxidase (LOX) as relevant targets and provide a larger framework for target and drug discovery in rare pediatric cancers.

show abstract

Section: Discussionmentioning

confidence: 99%

In Vivo Expansion of Cancer Stemness Affords Novel Cancer Stem Cell Targets: Malignant Rhabdoid Tumor as an Example

et al. 2018

View full text Add to dashboard Cite

show abstract

“…utilized CRISPR/Cas9 technology to integrate a lineage-tracing cassette in the LGR5 locus in human CRC organoids [48]. Using this approach, the authors also show that LGR5+ CRC cells self- unexpected functional and phenotypic plasticity of pancreatic TICs in vivo [49]. The authors go one step further to propose that CSCs (or TICs) are not fixed hardwired entities, but rather states and therefore from a therapeutic perspective, therapies for PDAC should be designed "to target TIC activation, rather than a fixed TIC population.…”

Section: Cancer Stem Cells -Hardwired Defined Entity or A Plasticmentioning

confidence: 97%

Pancreatic cancer stem cells: A state or an entity?

Hermann

Sáinz

2018

Seminars in Cancer Biology

View full text Add to dashboard Cite

Pancreatic ductal adenocarcinoma (PDAC), the most common type of pancreatic cancer, has a median overall survival of 6-12 months and a 5-year survival of less than 7%. While PDAC currently represents the 4th most frequent cause of death due to cancer worldwide, it is expected to become the second leading cause of cancer-related death by 2030. These alarming statistics are primarily due to both the inherent chemoresistant and metastatic nature of this tumor, and the existence of a subpopulation of highly plastic "stem"-like cells within the tumor, known as cancer stem cells (CSCs). Since their discovery in PDAC in 2007, we have come to realize that pancreatic CSCs have unique metabolic, autophagic, invasive, and chemoresistance properties that allow them to continuously self-renew and escape chemo-therapeutic elimination. More importantly, the concept of the CSC as a fixed entity within the tumor has also evolved, and current data suggest that CSCs are states rather than defined entities. Consequently, current treatments for the majority of PDAC patients are not effective, and do not significantly impact overall patient survival, as they do not adequately target the plastic CSC sub-population nor the transient/hybrid cells that can replenish the CSC pool. Thus, it is necessary that we improve our understanding of the characteristics and signals that maintain and drive the pancreatic CSC population in order to develop new therapies to target these cells. Herein, we will provide the latest updates and knowledge on the inherent characteristics of pancreatic CSCs and the CSC niche, specifically the cross-talk that exists between CSCs and niche resident cells. Lastly, we will address the question of whether a CSC is a state or an entity and discuss how the answer to this question can impact treatment approaches.

show abstract

“…PDAC patient-derived cultures were cultured as described (33) and harvested for mRNA extraction (RNAEasy Mini Kit, Qiagen) and cDNA synthesis (RevertAid First Strand cDNA Synthesis Kit, Life Technologies; K1622). KRAS Exon 2 was amplified by PCR using Phusion High-Fidelity PCR Kit (NEB) with the following primers: KRAS Forward: GCCATTTCGGACTGGGAGCGA; KRAS Reverse: GGCATCATCAACACCCAGATTAC.…”

Section: Kras Mutation Analysismentioning

confidence: 99%

NRG1 Fusions in KRAS Wild-Type Pancreatic Cancer

et al. 2018

Self Cite

View full text Add to dashboard Cite

We used whole-genome and transcriptome sequencing to identify clinically actionable genomic alterations in young adults with pancreatic ductal adenocarcinoma (PDAC). Molecular characterization of 17 patients with PDAC enrolled in a precision oncology program revealed gene fusions amenable to pharmacologic inhibition by small-molecule tyrosine kinase inhibitors in all patients with wild-type () tumors (4 of 17). These alterations included recurrent rearrangements predicted to drive PDAC development through aberrant ERBB receptor-mediated signaling, and pharmacologic ERBB inhibition resulted in clinical improvement and remission of liver metastases in 2 patients with-rearranged tumors that had proved resistant to standard treatment. Our findings demonstrate that systematic screening of tumors for oncogenic fusion genes will substantially improve the therapeutic prospects for a sizeable fraction of patients with PDAC. Advanced PDAC is a malignancy with few treatment options that lacks molecular mechanism-based therapies. Our study uncovers recurrent gene rearrangements such as fusions as disease-driving events in tumors, thereby providing novel insights into oncogenic signaling and new therapeutic options in this entity. .

show abstract

Succession of transiently active tumor‐initiating cell clones in human pancreatic cancer xenografts

Cited by 39 publications

References 62 publications

In Vivo Expansion of Cancer Stemness Affords Novel Cancer Stem Cell Targets: Malignant Rhabdoid Tumor as an Example

In Vivo Expansion of Cancer Stemness Affords Novel Cancer Stem Cell Targets: Malignant Rhabdoid Tumor as an Example

Pancreatic cancer stem cells: A state or an entity?

NRG1 Fusions in KRAS Wild-Type Pancreatic Cancer

Contact Info

Product

Resources

About