Successful fishing for nucleus pulposus progenitor cells of the intervertebral disc across species

Abstract

Background Recently, Tie2/TEK receptor tyrosine kinase (Tie2 or syn. angiopoietin‐1 receptor) positive nucleus pulposus progenitor cells were detected in human, cattle, and mouse. These cells show remarkable multilineage differentiation capacity and direct correlation with intervertebral disc (IVD) degeneration and are therefore an interesting target for regenerative strategies. Nevertheless, there remains controversy over the presence and function of these Tie2 + nucleus pulposus cells (NPCs), in part due to the difficulty of identification and isolation. Purpose Here, we present a comprehensive protocol for sorting of Tie2 + NPCs from human, canine, bovine, and murine IVD tissue. We describe enhanced conditions for expansion and an optimized fluorescence‐activated cell sorting‐based methodology to sort and analyze Tie2 + NPCs. Methods We present flow cytometry protocols to isolate the Tie2 + cell population for the aforementioned species. Moreover, we describe crucial pitfalls to prevent loss of Tie2 + NPCs from the IVD cell population during the isolation process. A cross‐species phylogenetic analysis of Tie2 across species is presented. Results Our protocols are efficient towards labeling and isolation of Tie2 + NPCs. The total flow cytometry procedure requires approximately 9 hours, cell isolation 4 to 16 hours, cell expansion can take up to multiple weeks, dependent on the application, age, disease state, and species. Phylogenetic analysis of the TEK gene revealed a strong homology among species. Conclusions Current identification of Tie2 + cells could be confirmed in bovine, canine, mouse, and human specimens. The presented flow cytometry protocol can successfully sort these multipotent cells. The biological function of isolated cells based on Tie2 + expression needs to be confirmed by functional assays such as in vitro differentiation. in vitro culture conditions to maintain and their possible proliferation of the Tie2 + fraction is the subject of future research.

Annulus fibrosus cell sheets limit disc degeneration in a rat annulus fibrosus injury model

“…As exemplified by the work of Likhitpanichkul et al, which demonstrated that a fibrin‐genipin composition applied as a sealant for a large AF defect in bovine IVD within a bioreactor culture system, could limit the biomechanical deterioration resulting from the defect . The observation period, however, was relatively short and although cell infiltration could be observed, it remains to be determined whether application of cell engraftment is required, especially considering the limited densities and potency of endemic IVD cells …”

“…33 The observation period, however, was relatively short and although cell infiltration could be observed, it remains to be determined whether application of cell engraftment is required, especially considering the limited densities and potency of endemic IVD cells. [34][35][36] F I G U R E 3 Gross anatomical change observations. A, Macroscopic observations revealed a decrease in disc height and disappearance of NP structure in group D. Disc height was maintained in group S, and NP structure was similar to that of group C. B, Thompson grading system score was 4.1 at week 4 in group D but gradually degenerated to 4.4 after 12 weeks.…”

Wnt3a and wnt5a as Potential Chondrogenic Stimulators for Nucleus Pulposus Cell Induction: A Comprehensive Review

“…74 Nevertheless, IVD cells are commonly derived from compromised tissue sources presenting low cellular yield and reduced cell potency. 10,74,75 Moreover, standard expansion of NP cells in vitro further reduces their overall potency. 75,76 From our current review, however, neither wnt3a nor wnt5a seem to have a clear beneficial effect on NP cell proliferation induction to enhance cell numbers, maintain overall potency, or induce a chondrogenic phenotype in vitro (Figs.…”

Minimal Sustainability of Dedifferentiation by ROCK Inhibitor on Rat Nucleus Pulposus Cells In Vitro

“…Primer Sequence. Target Forward primer Reverse primer SOX9 GCACATCAAGACGGAGCAAC AGGTTGAAGGGGCTGTAGGA COL2A1 CCAGGTCCTGCTGGAAAA CCTCTTTCTCCGGCCTTT ACAN GCAGGGATAACGGACTGAAG CAAGAGTAAAGTGGTCATAGTTCAGC COL1A1 CATGTTCAGCTTTGTGGACCT GCAGCTGACTTCAGGGATGT GAPDH CAACTCCCTCAAGATTGTCAGCAA GGCATGGACTGTGGTCATGA serve, and enable cell recovery from their storage condition 12) , which is hindered by rapid dedifferentiation of IVDderived nucleus pulposus (NP) cells in monolayer culture, as indicated by a loss in Aggrecan, type II collagen (COL2A1), and SOX9 expression [13][14][15] , forming an obstacle for the development of NP cell transplantation products 12) . Rho kinase (ROCK) is an intracellular serine/threonineoxidizing kinase that was identified as a target of the Rho protein, a low-molecular-weight GTP-binding protein.…”

“…Although it was reported that ROCKi suppresses dedifferentiation during monolayer culture of chondrocytes 16) , the effect of ROCKi on NP cells is less established. As such, it might prove beneficial to examine ROCKi on NP cells to potentially maintain their phenotype for research and therapeutic purposes, in particular considering the need to expand NP cells for obtaining sufficient cell numbers for a therapeutic application 17) , keeping in mind the limited cell yields from IVD specimen 13) . Therefore, we evaluated the impact of ROCKi Y-27632 as a culture medium supplement for maintaining cell phenotype of rat NP cells in monolayer culture for potential translation to prospective cell-based transplantation products.…”