Study of the role of microRNAs 16 and 135a in patients with lifelong premature ejaculation receiving fluoxetine daily for 3 months: A prospective case control study

Bartold, P. Mark; Motawi, Ahmad; Rashed, Laila Ahmed; Elghobary, Hany; Saad, Hany Mohammed; Ismail, Mohamed; Abdel‐latif, Hesham Fouad

doi:10.1111/and.14549

Cited by 3 publications

(5 citation statements)

References 20 publications

(37 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Drugs targeting DA and its receptors have been investigated, with a clinical study demonstrating that DA-like compound extended ejaculation [ 17 ]. Although we didn’t find significant differences in DA among the different groups, GamalEl Din et al [ 18 ] provided that fluoxetine administration significantly changed microRNAs 16 and 135a expression in the patients with premature ejaculation, indicating that these microRNAs are related to serotonin but not dopamine. Moreover, the contradiction to ours might also due to the different treatment drugs.…”

Section: Discussioncontrasting

confidence: 60%

See 1 more Smart Citation

Mechanism of Shugan Yidan fang, a Chinese herbal formula, in rat model of premature ejaculation

Han,

Guo,

Wang

et al. 2023

Basic Clin. Androl.

View full text Add to dashboard Cite

Background Premature ejaculation (PE) is one of the most common forms of sexual dysfunction in men, and multimodal therapeutic regimens should be considered to treat the condition. We developed a Chinese medicine herbal medicine, Shugan Yidan fang that had a significant clinical effect on PE patients, extending the time between penetration and ejaculation. However, the mechanism of this formula remains unclear. There is evidence that PE is associated with peripheral neuropathology, and the actions of dopamine (DA) and 5-hydroxytryptamine (5-HT). The aim of this study was to investigate the mechanism of Shugan Yidan fang’s effect on PE through the relationship between sexual behavioristics and the level of neurotransmitters and dopamine receptors (DARs). Results We showed that the male PE groups had a significant PE phenotype compared to healthy rats. Treatment with Shugan Yidan fang improved the behavioristics of the PE rats, and reduced the expression of DAR mRNA and protein while improving dopamine transporter levels. Conclusions Our study provided evidence for the beneficial effect of Shugan Yidan fang in PE therapy, and proposed a preliminary potential mechanism for the clinical application of the formula.

show abstract

Section: Discussioncontrasting

confidence: 60%

“…Despite this possibility, our results provide an indicator reference for the use of Shugan Yidan fang. Also similar to GamalEl Din that showed miRNA 135a was associated with the response of fluoxetine [ 18 ], we consider that patients with a high level of DARs may benefit from administration of Shugan Yidan fang.…”

Section: Discussionsupporting

confidence: 56%

Mechanism of Shugan Yidan fang, a Chinese herbal formula, in rat model of premature ejaculation

Han,

Guo,

Wang

et al. 2023

Basic Clin. Androl.

View full text Add to dashboard Cite

show abstract

“…The effect of the rapid 5‐HT increase exceeds the compensation effect of negative feedback auto‐regulation, and the 5‐HT in the synaptic gap is greatly increased, which combines with the postsynaptic membrane receptor and plays the role of delaying ejaculation. A recent study confirmed that in patients with Lifelong premature ejaculation (LPE), SSRIs not only inhibit the function of serotonin transporter (SERT) but also downregulates the expression of SERT by upregulating the expression of miRNA135a, thereby delaying ejaculation time 26 . In our study, we found that after treatment with dapoxetine, not only the concentration of 5‐HT increased significantly, but the expression level of DRD4 also increased significantly, and both 5‐HT and DRD4 were highly correlated with the changes in sexual behavior.…”

Section: Discussionmentioning

confidence: 91%

Vital function of DRD4 in dapoxetine medicated premature ejaculation treatment

et al. 2023

View full text Add to dashboard Cite

Background Recently, dapoxetine has been widely accepted to treat premature ejaculation by fast‐inhibiting 5‐hydroxytryptamine reuptake. However, dapoxetine is not suitable for all premature ejaculation patients in clinical treatment. We need to investigate and reveal the mechanism deeply to solve this problem. Objectives To investigate and reveal the function of dopamine D4 receptor in dapoxetine medicated premature ejaculation treatment. Materials and methods A rat model was used to screen rapid ejaculators. The molecular mechanisms of histone serotonylation‐mediated regulation of dopamine D4 receptor were demonstrated by chromatin immunoprecipitation, DNA pull‐down, mass spectrometry analysis, and coimmunoprecipitation experiments. The biological function of dopamine D4 receptor was investigated through in vivo experiments by intrathecal injection of shDRD4 to knockdown dopamine D4 receptor. Results In this study, we found that dapoxetine increased expression of 5‐hydroxytryptamine and dopamine D4 receptor. We demonstrated that dapoxetine increased levels of 5‐hydroxytryptamine, which promoted histone serotonylation (H3K4me3Q5ser) and transcription factor myeloid zinc‐finger 1 complex binding on the dopamine D4 receptor promoter, upregulated the expression of dopamine D4 receptor and thus delayed ejaculation. Discussion In this study, we demonstrated that dapoxetine increased the levels of 5‐hydroxytryptamine, which promoted histone serotonylation and myeloid zinc‐finger 1 complex binding to the dopamine D4 receptor promoter and upregulated the expression of dopamine D4 receptor, thus delaying ejaculation. Conclusion It is a novel mechanism that dapoxetine take effect of premature ejaculation treatment through upregulating the dopamine D4 receptor, which indicated that upregulated dopamine D4 receptor would enhance the dapoxetine effect in premature ejaculation treatment. This may lead to the development of novel therapeutic interventions for premature ejaculation.

show abstract

“…Complementary-DNA that had been prepared in a reverse-transcription reaction served as the template for quantitative real-time PCR analysis using miRCURY LNA miRNA PCR Panels, the miRCURY LNA SYBR® Green PCR Kit, and Real-Time PCR thermal cycler (Applied Biosystems; StepOne ™ Real-Time PCR, Foster City, CA, USA). The housekeeping miR-16-5P (5’GTTCCACTCTAGCAGCACGTAAATATTGGCGTAGTGAAATATATATTAAACACCAATATTACTGTGCTGCTTTAGTGTGAC3’) [ 19 ] was used as the endogenous control. Relative expression of miRNA-122 and miRNA-221 were calculated using the comparative cycle threshold method.…”

Section: Methodsmentioning

confidence: 99%

“…Regarding the effectiveness of direct acting antiviral (DAA) medication in preventing HCC recurrence, many studies reported heterogenous results. In HCV-infected individuals treated with DAAs, several studies have reported an unexpectedly high prevalence of early HCC recurrence [ 17 – 19 ]. As a result, a precise assessment of HCC risk factors is critical for well-designed HCC preventive measures.…”

Section: Introductionmentioning

confidence: 99%

Study of some potential biomarkers in Egyptian hepatitis C virus patients in relation to liver disease progression and HCC

Baraka,

Abozahra,

Badr

et al. 2023

BMC Cancer

View full text Add to dashboard Cite

Background Egypt has the greatest prevalence of hepatitis C worldwide according to the WHO reports, accounting for 13% of the global HCV infections. HCV is a substantial precursor for fibrosis, cirrhosis, and hepatocellular carcinoma. This study aimed to investigate the potential relevance of some cytokines, miR-122 and miR-221 for the diagnosis of liver disease progression associated to HCV infection. Methods One hundred and twenty blood samples were collected from patients with chronic liver disease, HCC, and healthy individuals. Total bilirubin, alanine aminotransferase, aspartate aminotransferase, platelet count, albumin, and creatinine were measured. Serum level of selected cytokines was conducted by ELISA. Serum miRNA expression was detected by RT-PCR. Results IL-2R was higher among HCC patients and the mean concentration of both TNF-αRII and IL-6R was higher among cirrhotic patients. The expression of miRNA-122 showed a little fold decrease in all studied groups; the highest level was observed in HCC patients. The expression of miRNA-221 showed a significant fold increase in HCC and cirrhotic groups. Conclusions This study revealed that there is no difference in liver disease progression in patients regarding sex and age. Routine liver function tests performed poorly in terms of early diagnosis of liver disease progression; however, serum total bilirubin gave somewhat useful guide for discrimination between fibrotic, cirrhotic and HCC cases. IL-2R showed a significant consistent increase in its level with disease progression. The miR-221 serum level showed significant fold increase with liver disease progression. Therefore, making miR-221 a potential non-invasive biomarker for liver disease progression in the diagnostic setting is recommended.

show abstract

Study of the role of microRNAs 16 and 135a in patients with lifelong premature ejaculation receiving fluoxetine daily for 3 months: A prospective case control study

Cited by 3 publications

References 20 publications

Mechanism of Shugan Yidan fang, a Chinese herbal formula, in rat model of premature ejaculation

Mechanism of Shugan Yidan fang, a Chinese herbal formula, in rat model of premature ejaculation

Vital function of DRD4 in dapoxetine medicated premature ejaculation treatment

Study of some potential biomarkers in Egyptian hepatitis C virus patients in relation to liver disease progression and HCC

Contact Info

Product

Resources

About