Study of bacterial and fungal community structures in traditional koumiss from Inner Mongolia

Guo, Liang; Ya, Mei; Guo, Yiting; Xu, Weiliang; Li, Chundong; Sun, Jiankang; Zhu, Jianjun; Qian, Jun-Ping

doi:10.3168/jds.2018-15155

Cited by 36 publications

(32 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Furthermore, Firmicutes dominated in all samples, representing 77.15%, 77.05%, 90.39%, 91.42%, 75.91%, 56.45%, 92.58%, 92.11%, and 92.25% of the sequence reads from Khoormog, Chigee, and Airag from Xilingol region, respectively. In the previous researches of traditionally fermented products (vrum, koumiss, and tarag), the identical four phyla had been identified as major phyla, along with the predominance of Firmicutes (Guo et al., 2019; Sun et al., 2014; Yamei et al., 2019).…”

Section: Resultsmentioning

confidence: 99%

“…Airag (cow) consisted of Lactobacillus (62.78%), Lactococcus (29.12%), and Acetobacter (6.08%). Previous studies reported that Lactobacillus and Lactococcus represent the major genera in TFDP, while Acetobacter , Enterobacter , and Leuconostoc also comprise the bacterial community in dairy products, such as fermented vrum (Yamei et al., 2019), koumiss (Guo et al., 2019), tarag (Sun et al., 2014), hurood cheese, and jueke (Gao et al, 2017). In addition, a very small amount of contamination with Citrobacter , Raoultella , and Escherichia‐Shigella was detected in several samples.…”

Section: Resultsmentioning

confidence: 99%

“…The physicochemical composition and microbial community were investigated in TFDP from mare and cow (Guo et al., 2019; Sun et al., 2014). However, there has been none of the researches on both nutritional properties and microbiota of Khoormog from camel's milk.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Comparative study of physicochemical composition and microbial community of Khoormog, Chigee, and Airag, traditionally fermented dairy products from Xilin Gol in China

Guo¹,

Xu²,

Li³

et al. 2021

Food Science & Nutrition

Self Cite

View full text Add to dashboard Cite

Due to their outstanding nutritional and functional properties, the traditionally fermented dairy products (TFDP) from camel, mare, and cow gained universal praise during their long history of production. In this study, the physicochemical composition and microbial communities of Khoormog, Chigee, and Airag, the TFDP from Xilin Gol in China, were investigated and compared. The physicochemical analysis revealed a higher content of total solid content, protein, and fat in Khoormog (12.5 ± 1.6%; 4.6 ± 0.7%; 4.4 ± 1.3%) compared to Chigee (7.8 ± 1.3%; 2.1 ± 0.2%; 0.8 ± 0.2%) and Airag (8.9 ± 0.7%; 3.7 ± 0.4%; 1.4 ± 0.5%). All three types of TFDP shared 41.2% of bacterial and 25.4% of fungal OTUs, and 95.34% of bacterial and 95.52% of fungal sequence reads. The bacterial and fungal community consisted of four phyla and five genera, and three phyla and seven genera, respectively. Lastly, Lactobacillus predominated in Khoormog, Chigee, and Airag at the genus level, while the dominant fungal genera varied among the samples. In conclusion, the microbial community structures of TFDP from camel, mare, and cow were not significantly different in a definite area (Xilingol region), and Khoormog, Chigee, and Airag bred the common “core microbiota”.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Comparative study of physicochemical composition and microbial community of Khoormog, Chigee, and Airag, traditionally fermented dairy products from Xilin Gol in China

Guo¹,

Xu²,

Li³

et al. 2021

Food Science & Nutrition

Self Cite

View full text Add to dashboard Cite

show abstract

“…For bacteria, the 16S rDNA V3‐V4 variable region was targeted using specific primers with barcode: 341F (CCTACGGGNGGCWGCAG) and 806R (GGACTACHVGGGTATCTAAT). For fungi, the ITS region was targeted using primers with barcode: ITS3_KYO2F (GATGAAGAACGYAGYRAA) and ITS4R (TCCTCCGCTTATTGATATGC) (Guo et al ., 2018). Polymerase chain reactions (PCR) were carried out under the following conditions: hotstart 95°C for 2 min, followed by 27 cycles of denaturation at 98°C for 10 s, annealing at 62°C for 30 s, elongation at 68°C for 30 s and a final extension at 68°C for 10 min.…”

Section: Methodsmentioning

confidence: 99%

Effect on the ensilage performance and microbial community of adding Neolamarckia cadamba leaves to corn stalks

Wang

Zhou

Wang

et al. 2020

Microbial Biotechnology

View full text Add to dashboard Cite

To comprehensively evaluate the fermentation performance and microbial community of corn stalks (CS) silage mixed with Neolamarckia cadamba leaves (NCL), CS were ensiled with four levels (0%, 10%, 30% and 50% of fresh weight) of NCL for 1, 7, 14, 30, 60 days in two trials. The results showed that all silages were well preserved with low pH (3.60-3.88) and ammonia nitrogen content (0.08-0.19% DM). The silage samples with NCL displayed lower (P < 0.05) acetic acid, propionic acid and ammonia nitrogen contents and lactic acid bacteria population during ensiling than control silages (100% CS). The addition of NCL also influenced the distribution of bacterial and fungal communities. Fungal diversity (Shannon's indices were 5.15-5.48 and 2.85-4.27 in trial 1 and trial 2 respectively) increased while the relative abundances of Lactobacillus, Leuconostocs, Acetobacter and two moulds (Aspergillus and Fusarium) decreased after added NCL. In summary, mixing NCL is a promising effective approach to preserve protein of CS silage and inhibit the growth of undesirable bacteria and mould, thus to improve the forage quality to some extent.

show abstract

“…In this study, S. agalactiae was found in the H milk and U KWL samples in the curd process, which was similar to the previous study of Liu et al (2012), who detected S. agalactiae in the traditional fermented yak milk in Tibet. Lactobacillus genus was the predominant strains in the curding stage of H and P KWL, and also was detected in other traditional fermented dairy products, such as yogurt-like product with added grape seed oil, Koumiss fermented with mare's milk, and milk bread (Rahman et al, 2009;Mercan et al, 2018;Guo et al, 2019). Janthinobacterium sp.…”

Section: Effect Of Milk Types On the Bacterial Community Structure Inmentioning

confidence: 98%

Effect of milk types on the attributes of a glutinous rice wine-fermented yogurt-like product

Gong

Peng

Ali

et al. 2020

Journal of Dairy Science

View full text Add to dashboard Cite

This study was conducted to analyze the effect of milk types on the attributes of the glutinous rice winefermented yogurt-like product named Kouwan Lao (KWL). Four types of raw milks were used in this study, including high temperature, long time (HTLT: H milk), HTLT milk supplemented with 3% skim milk powder (S milk), pasteurized milk (P milk), and ultra-high temperature milk (U milk). Microbiological compositions of the fermented glutinous rice and KWL at different stages were analyzed using PCR-denaturing gradient gel electrophoresis and gene sequencing based on 16S rRNA and 26S rRNA. The physicochemical properties of KWL samples were determined, and textural properties of those were analyzed using a texture analyzer (Jiawei Innovation and Technology Co. Ltd., Zhejiang Province, China). The microstructure of KWL samples was observed using scanning electron microscopy. The results showed that the milk types had significant influences on the bacterial composition of KWL. In the curdling process, the predominant bacteria of H, S, P, and U KWL samples were Lactobacillus brevis, Janthinobacterium sp., Lactobacillus casei, and Streptococcus agalactiae, respectively. In the ripening process, the main strains in H KWL were Enterococcus faecium and Pediococcus pentosaceus. Lactobacillus casei and Lactobacillus paracasei were the dominant bacteria of U KWL. Lactobacillus casei was the main strain of P KWL, and no bacteria were detected in S KWL. Saccharomyces cerevisiae was the dominant fungus of KWL, and no significant effect of milk types on fungal composition of KWL was found. The results of physicochemical properties showed that significant differences in protein contents were found in the KWL samples, and P KWL had the highest protein content. The fat content of U KWL was significantly higher than that of samples from the other 3 groups. The U KWL and P KWL showed lower moisture than that of the other 2 KWL samples. In addition, no significant difference in pH value was found in all samples. The results of texture analysis and microstructure showed that compared with other 3 types of KWL samples, the related mass parameters of U KWL were more advantageous and improved significantly with the increase of the heat treatment temperature of raw milk and the addition of skim milk powder. Our findings revealed the effects of milk types on microbial composition, physicochemical properties, textural properties, and microstructure of KWL, and provided a basic theory for the optimization and industrial production of KWL.

show abstract

Study of bacterial and fungal community structures in traditional koumiss from Inner Mongolia

Cited by 36 publications

References 43 publications

Comparative study of physicochemical composition and microbial community of Khoormog, Chigee, and Airag, traditionally fermented dairy products from Xilin Gol in China

Comparative study of physicochemical composition and microbial community of Khoormog, Chigee, and Airag, traditionally fermented dairy products from Xilin Gol in China

Effect on the ensilage performance and microbial community of adding Neolamarckia cadamba leaves to corn stalks

Effect of milk types on the attributes of a glutinous rice wine-fermented yogurt-like product

Contact Info

Product

Resources

About