Structure of the genes encoding the CD19 antigen of human and mouse B lymphocytes

Zhou, Libo; Ord, David C.; Omori, Sidne A.; Tedder, Thomas F.

doi:10.1007/bf00189519

Cited by 28 publications

(19 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The CD19/CD21 cell surface receptor complex transduces signals required for B-cell development and function (Hasegawa et al, 2001). CD19 is a surface marker expressed throughout B-cell development, first appearing on pro-B cells (Zhou et al, 1991). CD19-deficient mice have significantly fewer B cells in peripheral lymph nodes and spleen, impaired Bcell proliferation, and reduced serum Ig (Engel et al, 1995).…”

Section: Discussionmentioning

confidence: 99%

Evi3, a zinc-finger protein related to EBFAZ, regulates EBF activity in B-cell leukemia

et al. 2004

View full text Add to dashboard Cite

Retroviral insertions that activate proto-oncogenes are a primary cause of tumors in certain strains of mice. The AKXD recombinant inbred mice are predisposed to a variety of leukemias and lymphomas as a result of viral integration. One common insertion site, the ecotropic viral insertion site 3 (Evi3), has been implicated in most B-cell tumors in the AKXD-27 strain. The Evi3 gene encodes a zinc-finger protein with sequence similarity to the Early B-cell Factor-Associated Zinc-finger gene (EBFAZ). We show that the Evi3 gene is overexpressed in several tumors with viral insertions at Evi3, which results in the upregulation of Early B-cell Factor (EBF)-target gene expression, suggesting that Evi3 modulates EBF activity. Reconstitution of primary leukemia cells showed that these tumors express high densities of the Bcell surface proteins CD19 and CD38, which are EBF targets. Using a transactivation assay, we show that the terminal six zinc-fingers of Evi3 are required for modification of EBF activity. This is the first evidence that Evi3 expression in tumors alters the level of EBF target genes, and the first characterization of the Evi3 protein domains required for modulation of EBF activity. Further, these data imply that Evi3 misexpression initiates tumorigenesis by perturbing B-cell development via an interaction with EBF.

show abstract

Section: Discussionmentioning

confidence: 99%

Evi3, a zinc-finger protein related to EBFAZ, regulates EBF activity in B-cell leukemia

et al. 2004

View full text Add to dashboard Cite

show abstract

“…Therefore, the CD19 gene may be similar to the K light-chain gene, which can initiate B-cell-specific expression of foreign gene products (44). Although the K light-chain gene shares no significant homology with the CD19 gene, the CD19 gene contains sequences similar to the NFKB and ,uB motifs (52). Binding sites for the B-cell-specific activator protein/Pax-5 transcription regulatory factor have also been identified in the CD19 promoter region (2,20), although B-cell-specific activator protein/Pax-5 is found in the central nervous system and testis (2,3).…”

Section: Discussionmentioning

confidence: 99%

Tissue-specific expression of the human CD19 gene in transgenic mice inhibits antigen-independent B-lymphocyte development.

Zhou¹,

Smith²,

Waldschmidt³

et al. 1994

Mol. Cell. Biol.

110

104

View full text Add to dashboard Cite

CD19 is a B-cell-specific member of the immunoglobulin superfamily expressed from early pre-B-cell development until plasma cell differentiation. In vitro studies demonstrate that the CD19 signal transduction molecule can serve as a costimulatory molecule for activation through other B-lymphocyte cell surface molecules. However, much remains to be known regarding how CD19 functions in vivo and whether CD19 has different roles at particular stages of B-cell differentiation. Therefore, transgenic mice overexpressing the human CD19 (hCD19) gene were generated to determine whether this transgene would be expressed in a B-lineage-specific fashion and to dissect the in vivo role of CD19 in B-cell development and activation. Expression of the human transgene product was specifically restricted to all B-lineage cells and appeared early in development as occurs with hCD19. In addition, expression of hCD19 severely impaired the development of immature B cells in the bone marrow, with dramatically fewer B cells found in the spleen, peripheral circulation, and peritoneal cavity. CD19 (48,50), and the cytoplasmic domain of CD19 contains kinase insert regions that when phosphorylated mediate the binding and activation of phosphatidylinositol 3-kinase (47). Thus, although the precise in vivo function of CD19 has not been definitively elucidated, these studies support the hypothesis that the CD19 complex can serve an accessory role in conjunction with surface Ig to enhance antigen-driven B-cell activation (6).Although CD19 is one of the first lineage-specific surface molecules expressed during early pre-B-cell development, little is known about the functional importance of this molecule during early B-cell differentiation or the role of CD19 in vivo. However, the expression of cloned genes in transgenic mice can provide a direct readout of biological consequences of receptor function rather than the effects evoked following cross-linking of a receptor with MAb as has primarily been the approach for examining CD19 function. Further, the mouse model allows an analysis of the complex signaling pathways that occur during early B-cell hematopoiesis for which satisfactory tissue culture models do not exist. Therefore, the human CD19 (hCD19) gene was microinjected into mouse 3884 on April 4, 2019 by guest

show abstract

“…This region also contains the genes encoding the leukocyte adhesion receptors CD 11 a (Ly 15, LFA-1, 16p 13.1-p 11), CD 1 lb, and CD1 lc (Hogarth et al 1986;Corbi et al 1988). The mapping of hCD19 and mCdl9 genes to chromosomal regions conserved between species correlates with the high degree of similarity observed between these genes in their coding regions (Tedder and Isaacs 1989), 3' and 5'UT regions (Zhou et al 1991), and overall gene structure (Zhou et al 1992).…”

Section: Discussionmentioning

confidence: 99%

“…hCD19 gene sequences (Zhou et al 1992) for analysis for somatic and antisense (TGTCACCCTGGCATAAAAGC). All primers were synthesized, using an Applied Biosystems (Foster City, CA) EP391 oligonucleotide synthesizer.…”

Section: Polymerase Chain Reaction (Pcr) Primers Complementary Tomentioning

confidence: 99%

See 1 more Smart Citation

CD19 maps to a region of conservation between human chromosome 16 and mouse chromosome 7

et al. 1994

Self Cite

View full text Add to dashboard Cite

CD19 is a B lymphocyte cell surface protein expressed from the earliest stages of B lymphocyte development until their terminal differentiation into plasma cells. In this report the human CD19 gene (hCD19) was localized to band p11.2 on the proximal short arm of chromosome 16 by in situ hybridization to metaphase chromosomes, using hCD19 cDNA as probe. hCD19 gene localization was confirmed by polymerase chain reaction based analysis with hCD19-specific primers, using a panel of human/hamster somatic cell hybrid DNA as templates. The mouse CD19 gene (mCd19) was mapped to bands F3-F4 of chromosome 7 by in situ hybridization to metaphase chromosomes, using a mCD19 cDNA probe. Segregation analysis of nucleotide sequence polymorphisms in interspecific backcross progeny revealed linkage of mCd19 with hemoglobin beta (Hbb), Int-2, and H19, other loci previously mapped to the same region of mouse chromosome 7, confirming the localization of mCd19 to this region. The order of these loci was determined to be centromere--Hbb--mCd19--H19--Int-2--telomere. The genetic distances between the loci examined, calculated from the recombination frequencies, suggested that mCd19 was located centrally between Hbb and H19. This region of mouse chromosome 7 is homologous to the region of human chromosome 16 to which the hCD19 gene maps. Multiple genes with a lymphocyte-related function also map to this conserved region including genes encoding the IL-4 receptor, CD11a, CD11b, CD11c, CD43 (leukosialin), and protein kinase C beta polypeptide.

show abstract

Structure of the genes encoding the CD19 antigen of human and mouse B lymphocytes

Cited by 28 publications

References 38 publications

Evi3, a zinc-finger protein related to EBFAZ, regulates EBF activity in B-cell leukemia

Evi3, a zinc-finger protein related to EBFAZ, regulates EBF activity in B-cell leukemia

Tissue-specific expression of the human CD19 gene in transgenic mice inhibits antigen-independent B-lymphocyte development.

CD19 maps to a region of conservation between human chromosome 16 and mouse chromosome 7

Contact Info

Product

Resources

About