Structure‐guided design of immunomodulatory RNAs specifically targeting the cytoplasmic viral RNA sensor RIG‐I

Abstract

The cytoplasmic immune sensor RIG‐I detects viral RNA and initiates an antiviral immune response upon activation. It has become a potential target for vaccination and immunotherapies. To develop the smallest but potent immunomodulatory RNA (immRNAs) species, we performed structure‐guided RNA design and used biochemical, structural, and cell‐based methods to select and characterize the immRNAs. We demonstrated that inserting guanosine at position 9 to the 10mer RNA hairpin (3p10LG9) activates RIG‐I more robustly than the parental RNA. 3p10LG9 interacts strongly with the RIG‐I helicase‐CTD RNA sensing module and disrupts the auto‐inhibitory interaction between the HEL2i and CARDs domains. We further showed that 3p10LA9 has a stronger cellular activity than 3p10LG9. Collectively, purine insertion at position 9 of the immRNA species triggered more robust activation of RIG‐1.

Robust delivery of RIG‐I agonists using extracellular vesicles for anti‐cancer immunotherapy

“…The Luo group previously developed a series of immRNA species as potent RIG‐I agonists in human skin dendritic cells and macrophages (Ho et al., 2019 ; Yong et al., 2019 ). Among the immRNA variants, 3p10LA9 showed the strongest cellular IFNs‐producing activity.…”

“…We also tested a couple of 3′ end truncations. A dsDNA template of the modified 125b‐ASO sequence was inserted after the T7 promoter for efficient in vitro transcription (IVT) according to our established protocol (Luo et al., 2012 ; Yong et al., 2019 ). This resulted in a longer product due to the product RNA rebound to the T7 RNA polymerase and self‐primed (in cis) generation of a hairpin duplex (Figure S3A ) (Gholamalipour et al., 2018 ).…”

“…ImmRNAs were prepared following the protocol of Yong et al. ( 2019 ). Briefly, RNAs were transcribed in vitro using T7 RNA polymerase and a pair of primers (Forward: GGATTTCCCCCGAAGGTGGAAATCCTATAGTGAGTCGTATTAC; Reverse: GTAATACGACTCACTATAGGATTTCCACCTTCGGGGGAAATCC).…”

“…Thus, in this study, we sought to evaluate the effectiveness of RBCEVs in delivering RIG‐I agonists, including an immunomodulatory RNA (immRNA) and a bi‐functional ASO for anti‐cancer therapy. The immRNA is a small, stable and highly potent RIG‐I agonist capable of activating RIG‐I and subsequent anti‐viral responses in macrophages and dendritic cells (Ho et al., 2019 ; Kohlway et al., 2013 ; Luo et al., 2012 ; Yong et al., 2019 ). We hypothesize that delivery of either immRNA or anti‐miR‐125b ASO with a 5′ triphosphate modification (3p‐125b‐ASO) will induce a robust anti‐cancer response.…”

The molecular mechanism of RIG‐I activation and signaling

“…20,22,24,38,53 The dsRNA binding footprint of RIG-I is between 8 and 10 dsRNA base pairs, and indeed, blunt RNA duplexes as short as 10 base pairs trigger a rapid signaling response and potent IFN induction in cells and whole animals. 19,20,43,54,55,56,57,58 In the absence of a closed loop to stabilize the RNA duplex, 20,54 the minimal two-stranded RNA agonist for stimulating RIG-I in cells has been reported be ~19 bp, 19,59,60 which may be attributable to the relative instability of shorter RNA duplexes, particularly as they pass through cell membranes or bind to exonucleases.…”