Structure, chromosome location, and expression of the human smooth muscle (enteric type) gamma-actin gene: evolution of six human actin genes.

Abstract

Recombinant phages that carry the human smooth muscle (enteric type) -y-actin gene were isolated from human genomic DNA libraries. The amino acid sequence deduced from the nucleotide sequence matches those of cDNAs but differs from the protein sequence previously reported at one amino acid position, codon 359. The gene containing one 5' untranslated exon and eight coding exons extends for 27 kb on human chromosome 2. The intron between codons 84 and 85 (site 3) is unique to the two smooth muscle actin genes. In the 5' flanking region, there are several CArG boxes and E boxes, which are regulatory elements in some muscle-specific genes. Hybridization with the 3' untranslated region, which is specific for the human smooth muscle -y-actin gene, suggests the single gene in the human genome and specific expressions in enteric and aortic tissues. From characterized molecular structures of the six human actin isoform genes, we propose a hypothesis of evolutionary pathway of the actin gene family. A presumed ancestral actin gene had introns at at least sites 1, 2, and 4 through 8. Cytoplasmic actin genes may have directly evolved from it through loss of introns at sites 5 and 6. However, through duplication of the ancestral actin gene with substitutions of many amino acids, a prototype of muscle actin genes had been created. Subsequently, striated muscle actin and smooth muscle actin genes may have evolved from this prototype by loss of an intron at site 4 and acquisition of a new intron at site 3, respectively.

Transforming Growth Factor-β Induction of Smooth Muscle Cell Phenotpye Requires Transcriptional and Post-transcriptional Control of Serum Response Factor

“…In the case of SM-␣-actin, TGF-␤ responsiveness involves two separate cis-elements: 1) the CArG/SRE motif, which we found to mediate TGF-␤-induced SM-␥-actin expression and 2) a G-Arich TGF-␤ control element or TCE (11), which is recognized in the promoter region of various SM-specific genes, but whose involvement in TGF-␤ responsiveness of these genes has not been investigated (11). The segment of the SM-␥-actin gene promoter that we demonstrate here to be necessary for TGF-␤ activation of the gene (Ϫ135 bp) is highly conserved across species (14,16,18,49) and does not contain any obvious TCE motifs. However, we did observe multiple protein-DNA complexes formed with oligonucleotide containing the SM-␥-actin CArG/SRE and surrounding sequences.…”

“…These observations, combined with previous studies in vivo (43,15) and in vitro (42,46) 3 suggest that TGF-␤ regulation of SRF expression also involves post-transcritpional mechanism(s) of control. (14), human (18), mouse (49), and rat (75) containing the region surrounding the CARG/SRE2 motif is shown. The sequence from this highly conserved segment of the SM-␥-actin promoter contains an A-T-rich and homeodomain binding motifs in addition to the CArG/SRE2 element that function in SMGA transcription.…”

“…The probe used in this experiment ( 135 CAATAAAACACCTTATATGGCCATATGGCT Ϫ106 ) is a highly conserved segment of the SM-␥-actin promoter (Fig. 5A) and contains a number of cis-acting elements that have been shown to be critical for smooth muscle-specific SM-␥-actin transcription (14,15,18,49,75). Thus the formation of multiple complexes is likely due to several DNA-protein interactions.…”

Cell-specific nuclear import of plasmid DNA

“…[9][10][11][12][13] The avian SMGA gene promoter contains six CArG/SRE motifs ( Figure 1), four of which are known to be conserved in structure and location with the human and mouse SMGA genes. 14,15 Moreover, serum response factor (SRF), a highly conserved protein that is developmentally regulated in smooth muscle myogenesis and which binds to DNA as a heterodimer with multiple distinct partners, binds four of the six CArG/SRE motifs of the SMGA promoter. 7,8,16,17 The promoter also contains 13 Ebox motifs, three of which bind to a class of transcription factors, the bHLH family, exemplified by the muscle-specific factor MyoD.…”

The Smooth Muscle γ-Actin Gene Promoter Is a Molecular Target for the Mouse bagpipe Homologue, mNkx3-1, and Serum Response Factor

“…Differentiated smooth muscle cells are characterized by their expression of a unique subset of contractile protein isoforms including smooth muscle ␣-actin (15)(16)(17)(18), smooth muscle ␥-actin (17)(18)(19)(20)(21), smooth muscle myosin heavy and light chains (22)(23)(24), calponin (25), SM22␣ (26 -28), and telokin (29 -31). Furthermore, these cells possess the capability to express appropriate levels of these characteristic smooth muscle proteins even though they are derived from diverse embryonic origins (32).…”