Structure-activity relationship study of human interleukin-3: role of the C-terminal region for biological activity.

Abstract

A structure‐activity relationship study of human interleukin‐3 (huIL‐3) was performed by functional analysis of huIL‐3 deletion and substitution variants combined with epitope mapping of huIL‐3 specific neutralizing monoclonal antibodies (mAb). Analysis of the huIL‐3 variants was accomplished by defining their capacity to compete with wild‐type huIL‐3 for binding to the huIL‐3 receptor and to induce the proliferation of the huIL‐3 dependent cell line M‐O7. HuIL‐3 variants with either 14 amino acids (aa) deleted from the N‐terminus or eight aa from the C‐terminus retained full biological activity in vitro. An huIL‐3 variant, with 18 N‐terminal aa deleted, exhibited a greater than 7‐fold reduced receptor binding capacity and proliferative activity. No biological activity could be detected with a variant where 22 C‐terminal aa have been deleted. Neutralizing mAb recognizing presumed discontinuous epitopes failed to interact with the latter deletion variant indicating a possible location of their epitopes within the C‐terminal region. Computer‐aided structure prediction and sequence homology analysis of this region indicated the presence of an amphiphilic alpha‐helix with highly conserved residues like Lys110 and Leu111. Substitution of Lys110 with either Glu or Ala resulted in variants with a 10‐fold reduced activity in the receptor binding assay and the proliferation assay. Further variants, where Leu111 was substituted by Pro or Met, were totally inactive in these assays. Analysis of the binding of the two neutralizing mAb to these substitution variants showed that they did not bind to either of the Leu111 variants suggesting that Leu111 is part of an active site. Based on our results, a possible model for the structure of the huIL‐3 molecule can be constructed with two active sites in close proximity.

Evidence for a Lectin Activity for Human Interleukin 3 and Modeling of Its Carbohydrate Recognition Domain

“…Although the previous authors (7,8) did not demonstrate strong modification of the three-dimensional structure after the mutation, our in silico studies indicated that the conformation of the mutein (Fig. 4B) was significantly different from that of the non-mutated protein (Fig.…”

“…Indeed, site-directed mutagenesis (7, 8, 23, 27, 40 -43) of human IL-3 defined essential amino acids for binding to the IL-6R␣ and -3R␤ as residues Ser-17, Asn-18, Asp-21, Arg-22, Thr-25, Ser-42, Glu-43, Gln-45, Asp-46, Met-49, Arg-94, Pro-96, Arg-108, Lys-110, Leu-111, Phe-113, Lys-116, and Glu-119. Deletion of the first 14 amino acids (40) did not modify the receptor binding of IL-3, a property lost when the first 18 amino acids were deleted (8). No biological activity was found after deletion of the 22 C-terminal amino acids (8).…”

“…In Silico Determination of the Three-dimensional Structure of the P33G IL-3 Mutein-It was previously shown (7,8) that the P33G mutation provoked 14-fold increased biological activity for the mutein relative to the wild-type recombinant human IL-3. Although the previous authors (7,8) did not demonstrate strong modification of the three-dimensional structure after the mutation, our in silico studies indicated that the conformation of the mutein (Fig.…”

“…Computational docking of the lower energy conformers of the disaccharides from chondroitin-4-sulfate and chondroitin-6-sulfate, chondroitin-4,6-disulfate, chondroitin-2,4-disulfate, and chondroitin-2,6-disulfate results in a specific docking of GlcA(2S)␤1,3GalNAc(4S)␤1 in the area of Trp-104 previously proposed as a domain of IL-3 necessary for its function. Molecular modeling of the mutation P33G that gives a mutein with increased biological activity (7,8) indicates a complete modification of this domain (with the complete accessibility of Trp-104). In silico docking of all disaccharides described above indicates that the theoretical best ligand is no more GlcA(2S)␤1,3GalNAc(4S)␤1 but the classic disaccharide derived from chondroitin-4-sulfate.…”

Autogenous transcriptional activation of a thiostrepton-induced gene in Streptomyces lividans.

“…The fragment was cloned as an NdeI -SnaI fragment into an expression vector (pIP998) modified from pL-RCV (Lokker et al, 1991). In this plasmid, pNB2, lipAL transcription was directed by the bacteriophage X pL promoter controlled by the temperature-sensitive cI857 repressor in the chromosome of W31 10 (Lokker et al, 1991) Oligonucleotide 3, GCCCATATGGGAATCAACCTCACCCCG; Oligonucleotide 4, GGCGGCGTCCATGGCCCC.…”