Strong clustering and stereotyped nature of Notch3 mutations in CADASIL patients

Joutel, Anne; Vahedi, Katayoun; Corpechot, Christophe; Troesch, Alain; Chabriat, Hugues; Vayssière, Céline; Cruaud, Corinne; Maciazek, Jacqueline; Weissenbach, Jean; Bousser, Marie‐Germaine; Bach, Jean‐François; Tournier‐Lasserve, Elisabeth

doi:10.1016/s0140-6736(97)08083-5

Cited by 601 publications

(526 citation statements)

References 22 publications

Supporting

Mentioning

502

Contrasting

Unclassified

Order By: Relevance

“…Cerebral autosomal‐dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is the most common form of hereditary small vessel disease and is the most common genetic cause of stroke and vascular dementia in adults 1, 2. The clinical presentation of CADASIL is characterized by migraine with aura, transient neurological symptoms, mood disturbances and cognitive impairment 3, 4, 5, 6, 7.…”

Section: Introductionmentioning

confidence: 99%

Differences in proliferation rate between CADASIL and control vascular smooth muscle cells are related to increased TGFβ expression

Panahi

Mesri

Samuelsson

et al. 2018

J Cellular Molecular Medi

View full text Add to dashboard Cite

Cerebral autosomal‐dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is a familial fatal progressive degenerative disorder. One of the pathological hallmarks of CADASIL is a dramatic reduction of vascular smooth muscle cells (VSMCs) in cerebral arteries. Using VSMCs from the vasculature of the human umbilical cord, placenta and cerebrum of CADASIL patients, we found that CADASIL VSMCs had a lower proliferation rate compared to control VSMCs. Exposure of control VSMCs and endothelial cells (ECs) to media derived from CADASIL VSMCs lowered the proliferation rate of all cells examined. By quantitative RT‐PCR analysis, we observed increased Transforming growth factor‐β (TGFβ) gene expression in CADASIL VSMCs. Adding TGFβ‐neutralizing antibody restored the proliferation rate of CADASIL VSMCs. We assessed proliferation differences in the presence or absence of TGFβ‐neutralizing antibody in ECs co‐cultured with VSMCs. ECs co‐cultured with CADASIL VSMCs exhibited a lower proliferation rate than those co‐cultured with control VSMCs, and neutralization of TGFβ normalized the proliferation rate of ECs co‐cultured with CADASIL VSMCs. We suggest that increased TGFβ expression in CADASIL VSMCs is involved in the reduced VSMC proliferation in CADASIL and may play a role in situ in altered proliferation of neighbouring cells in the vasculature.

show abstract

Section: Introductionmentioning

confidence: 99%

Differences in proliferation rate between CADASIL and control vascular smooth muscle cells are related to increased TGFβ expression

Panahi

Mesri

Samuelsson

et al. 2018

J Cellular Molecular Medi

View full text Add to dashboard Cite

show abstract

“…The disease is characterized by recurrent TIAs and strokes with progressive vascular dementia, migraine with aura, psychiatric disturbances, and pseudobulbar palsy (2)(3)(4). In 1996, Joutel et al reported Notch3 as the causative gene for CADASIL, and detected several point mutations (5,6). However, most mutations identified were from Caucasian families, and so far, only a few families with the gene mutations have been reported amongthe Japanese population (7)(8)(9).…”

Section: Introductionmentioning

confidence: 99%

Two Japanese CADASIL Families with a R141C Mutation in the Notch3 Gene.

et al. 2001

View full text Add to dashboard Cite

show abstract

“…Exons 3 and 4 of the Notch3 gene were amplified using the following intronic primers: exon 3 (F: 5'TGTGCTGCCCAACCAAGCCA; R: 5'ACTGACCACACCCCCGACTA); exon 4 (F: 5'TAGTCGGGGGTGTGGTCAGT; R: 5'CCTCTGACTCTCCTGAGTAG). 17 PCR conditions were as follows: initial denaturation 5 min at 94°C, followed by 35 cycles at 94°C for 30 s (denaturation), 65°C for 30 s (annealing) and 72°C for 30 s (extension), with a 7 min final extension at 72°C. PCR products were subjected to direct automated sequencing using dideoxy-terminator cycle sequencing (BigDye™ sequencing Ready Reaction Kit, Perkin-Elmer, Foster City, CA) and an Applied Biosystems model 377 automated sequencer (Applied Biosystems division, Perkin-Elmer Corporation, Foster City, CA).…”

Section: Patientsmentioning

confidence: 99%

“…[10][11][12][13][14][15][16] On screening 50 CADASIL families for mutations along the entire coding sequence of the Notch3 gene, Joutel et al found mutations in 90% of the families. 17 All mutations were located in one of the 34 EGF-like repeat domains with a strong cluster in two exons coding for the first five repeats. All mutations were missense mutations predicted to result in a loss or a gain of cysteine residue.…”

Section: Introductionmentioning

confidence: 99%

“…Based on this observation the authors hypothesised that aberrant dimerisation of Notch3, due to abnormal disulfide bridging with another Notch3 molecule or with another protein, may be involved in the pathogenesis of the disorder. 17 In the current study we performed mutational analysis in 71 unrelated CADASIL families by focusing on exons 3 and 4 which code for the first five EGF-like repeats of the Notch3 gene product. 3D homology models were generated to study the potential effects of the observed mutations.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Small in-frame deletions and missense mutations in CADASIL: 3D models predict misfolding of Notch3v EGF-like repeat domains

Dichgans¹,

Ludwig²,

Müller‐Höcker

et al. 2000

Eur J Hum Genet

113

View full text Add to dashboard Cite

CADASIL (cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy) is a hereditary microangiopathic condition causing stroke in young adults. The responsible gene has recently been identified as the Notch3 gene. Notch3 encodes a large transmembrane receptor with 34 extracellularly localised epidermal growth factor-like (EGF) repeat domains. We screened 71 unrelated CADASIL families for mutations in two exons coding for the first five EGF-like repeats and found mutations in 70% of the families (n = 50). Two types of mutations were identified: 48 families (96%) had missense mutations and two families (4%) had small in-frame deletions. Seven mutations occurred multiple times. All of them are C to T transitions that affect CpG dinucleotides, suggesting that their multiple occurrence is due to the hypermutability of this sequence. All mutations, including the two deletions, result in the gain or loss of a cysteine residue, thus substantiating the pivotal role of an uneven number of cysteine residues within EGF-like repeat domains of Notch3 in the pathogenesis of CADASIL. To study the potential effects of these mutations 3D homology models of the first six EGF domains were generated on the basis of NMR data from human fibrillin-1. These models predict domain misfolding for a subset of mutations.

show abstract

Strong clustering and stereotyped nature of Notch3 mutations in CADASIL patients

Cited by 601 publications

References 22 publications

Differences in proliferation rate between CADASIL and control vascular smooth muscle cells are related to increased TGFβ expression

Differences in proliferation rate between CADASIL and control vascular smooth muscle cells are related to increased TGFβ expression

Two Japanese CADASIL Families with a R141C Mutation in the Notch3 Gene.

Small in-frame deletions and missense mutations in CADASIL: 3D models predict misfolding of Notch3v EGF-like repeat domains

Contact Info

Product

Resources

About