Striking similarities between publications from China describing single gene knockdown experiments in human cancer cell lines

Abstract

International audienceComparing 5 publications from China that described knockdowns of the human TPD52L2 gene in human cancer cell lines identified unexpected similarities between these publications, flaws in experimental design, and mis-matches between some described experiments and the reported results. Following communications with journal editors, two of these TPD52L2 publications have been retracted. One retraction notice stated that while the authors claimed that the data were original, the experiments had been out-sourced to a biotechnology company. Using search engine queries, automatic text-analysis, different similarity measures, and further visual inspection, we identified 48 examples of highly similar papers describing single gene knockdowns in 1–2 human cancer cell lines that were all published by investigators from China. The incorrect use of a particular TPD52L2 shRNA sequence as a negative or non-targeting control was identified in 30/48 (63%) of these publications, using a combination of Google Scholar searches and visual inspection. Overall, these results suggest that some publications describing the effects of single gene knockdowns in human cancer cell lines may include the results of experiments that were not performed by the authors. This has serious implications for the validity of such results, and for their application in future research

Digital magic, or the dark arts of the 21stcentury—how can journals and peer reviewers detect manuscripts and publications from paper mills?

“…). We have reported highly similar papers studying the functions of human genes in cancer cell lines that describe wrongly identified nucleotide sequence reagents . These reagents are not affected by minor typographic errors, but instead show genetic identities that are completely different from their text descriptions (Figs and ).…”

“…In a high-throughput setting, manuscript writers could copy identifiers corresponding to misidentified or A B [24] results (green, yellow, or red hypertext) [11]. The test publication [22] is part of the Seek & Blastn reference publication cohort [10,11], and its nearest text match is therefore the same publication. Two nucleotide sequences represented previously reported sequences (Seq A and Seq D) [10].…”

Communal data work: Data sharing and re-use in clinical genetics

“…For instance, a senior cancer researcher from Australia questioned the veracity of results reported in a series of journal publications on a specific gene in 2015 after realizing that the nucleotide sequences reported were not right [36]. She also identified unexpected similarities between these unconvincing publications, flaws in experimental design, and mismatches between some described experiments and the reported results [37]. Following communications with journal editors, some of these gene-specific publications have been retracted.…”

Retracted: Long Noncoding RNA KIAA0125 Potentiates Cell Migration and Invasion in Gallbladder Cancer

“…BioMed Research International has retracted the article titled “Long Noncoding RNA KIAA0125 Potentiates Cell Migration and Invasion in Gallbladder Cancer” [ 1 ]. This article is one of a series of very similar articles on shRNA and cancer cell lines identified by Byrne and Labbé [ 2 ]; the intertextual distance between this article and another of the series [ 3 ] is lower than expected by chance. The following concerns were found: The supposed nontargeting control shRNA sequence, 5 GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3, targets TPD52L2 (NM_199360).…”