Strain and process development for the production of human cytokines inHansenula polymorpha

Abstract

The early status of strain development for the production of interleukin (IL)-6, IL-8, IL-10, and interferon (IFN) gamma is described. The general approach to generating such strains was to amplify gene sequences encoding the mature forms of the various cytokines by PCR from commercially available cDNA sources. The design of the amplificates allowed an in-frame fusion to an MFalpha1 leader segment contained in two basic expression vectors, pFPMT121-MFalpha1 and pTPSMT-MFalpha1. The two vectors differ in that one harbors the methanol-inducible FMD promoter and the other the constitutive TPS1 promoter as control elements for heterologous gene expression. The most advanced process development example is that of IFNalpha-2a. Here, the MOX promoter derived from another key gene of methanol metabolism is used for expression control. The successful development of a production process for Hansenula polymorpha-derived IFNalpha-2a is summarized. This was achieved by combining genetic engineering of suitable production strains with improved processing capabilities for the secreted cytokine, and by purification procedures from cultures grown in yeast extract-peptone-glycerol-based media.

Design of Vectors for Efficient Integration and Transformation in Hansenula polymorpha

“…The methylotrophic yeast, Hansenula polymorpha, is used as an expression system for largescale production of many heterologous proteins , Mayer et al 1999, Degelmann et al 2002. The strong inducible promoter elements of the formate dehydrogenase (FMD) (Gellissen et al 1991) and the methanol oxidase gene (Fellinger et al 1991) have been used to promote the expression of foreign proteins in H. polymorpha.…”

Application of a wide-range yeast vector (CoMed™) system to recombinant protein production in dimorphic Arxula adeninivorans, methylotrophic Hansenula polymorpha and other yeasts

“…For comparative production, the cytokine IL-6, a secreted protein of industrial relevance, was selected. Recombinant expression systems for IL-6 have been established among others based on E. coli [38] and S. cerevisiae [39], in addition attempts have been described for H. polymorpha [40,41]. In both systems, production is hampered by N-terminal truncation of the product, elicited by a thiol protease that cleaves the mature protein at Arg8 (Arg9 in E. coli ) [42].…”

Production of interleukin-6 inArxula adeninivorans, Hansenula polymorphaandSaccharomyces cerevisiaeby applying the wide-range yeast vector (CoMed™) system to simultaneous comparative assessment

“…New elements are being developed that provide integration in copy numbers 10–20, thereby increasing the copy number‐dependent productivity and minimizing the difference in productivity among the various hosts. Recombinant expression systems for IL‐6 have been established based on, among others, E. coli (Tonouchi et al , 1988), S. cerevisiae (Guisez et al , 1991) and H. polymorpha (Degelmann et al , 2002; Gellissen et al , 2002). In the E. coli system, the protein undergoes specific cleavage by a thiol protease, yielding two new N‐termini (Proudfoot et al , 1993).…”

“…1) was used for the expression of the MAT α ‐IL6 fusion gene. For plasmid construction, the MAT α ‐IL6 ORF (Degelmann et al , 2002) was amplified in vitro in a PCR reaction using primers that incorporate flanking EcoRI and BamHI cleavage sites (5′‐ GAATTC ATGAGATTTCCTTCAATTTTTACT‐3′, nucleotide positions 1–24, EcoRI restriction site in bold type; 5′‐ GGATCC CTACATTTGCCGAAGAGCCC‐3′, nucleotide positions 807–788, BamHI restriction site in bold type). The resulting EcoRI–BamHI‐flanked MAT α ‐IL6 ORF was inserted into the plasmid pBS‐TEF‐PHO5 between the A. adeninivorans ‐derived TEF1 promoter and the S. cerevisiae ‐derived PHO5 terminator.…”

“…Intracellular and extracellular proteins were separated on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS‐PAGE) gels under reducing conditions according to Kunze et al (1995), and visualized by Coomassie Brilliant Blue R 250 colorization and silver staining. Western blot analysis and microplate enzyme‐linked immunosorbent assay (ELISA) detection were carried out according to standard methods using polyclonal antibodies (Degelmann et al , 2002). Sources for antibodies and for product standards were affinity‐purified goat anti‐rhIL6 IgG (R&D Systems, USA) and E. coli ‐derived human IL‐6 standard (Biomol, USA).…”