Stochastic loss and gain of symmetric divisions in the C. elegans epidermis perturbs robustness of stem cell number

Abstract

Biological systems are subject to inherent stochasticity. Nevertheless, development is remarkably robust, ensuring the consistency of key phenotypic traits such as correct cell numbers in a certain tissue. It is currently unclear which genes modulate phenotypic variability, what their relationship is to core components of developmental gene networks, and what is the developmental basis of variable phenotypes. Here, we start addressing these questions using the robust number of Caenorhabditis elegans epidermal stem cells, known as seam cells, as a readout. We employ genetics, cell lineage tracing, and single molecule imaging to show that mutations in lin-22, a Hes-related basic helix-loop-helix (bHLH) transcription factor, increase seam cell number variability. We show that the increase in phenotypic variability is due to stochastic conversion of normally symmetric cell divisions to asymmetric and vice versa during development, which affect the terminal seam cell number in opposing directions. We demonstrate that LIN-22 acts within the epidermal gene network to antagonise the Wnt signalling pathway. However, lin-22 mutants exhibit cell-to-cell variability in Wnt pathway activation, which correlates with and may drive phenotypic variability. Our study demonstrates the feasibility to study phenotypic trait variance in tractable model organisms using unbiased mutagenesis screens.

DnaJ chaperones contribute to canalization

“…The development of the seam cells is canalized to the point of eutely, so that during normal development the balance of asymmetric and symmetric divisions maintains a constant seam cell number (Sulston and Horvitz, ). Variation in the number of seam cells can be used as a metric for phenotypic variation in animals subjected to genetic perturbation in addition to environmental stress (Mestek Boukhibar and Barkoulas, ; Katsanos et al, ). In C. elegans , we find that a number of DnaJs, not limited to ER‐associated chaperones, are involved in canalization.…”

Variability in β-catenin pulse dynamics in a stochastic cell fate decision inC. elegans

“…Fewer have been found that are required for eff-1 activation, which could also provide additional noise or variability into the cell fate decision. Studies have shown a lin-22 loss-of-function mutation decreases P3.p cell fusion frequencies (Katsanos et al, 2017;Schlager et al, 2006). LIN-22 codes for a Hairy/Enhancer of Split-related transcription factor, which was found to act in the Wnt pathway by repressing egl-18, a GATA transcription factor, also a repressor of cell fusion in the seam cells (Gorrepati et al, 2013;Katsanos et al, 2017;Wrischnik and Kenyon, 1997).…”

“…Studies have shown a lin-22 loss-of-function mutation decreases P3.p cell fusion frequencies (Katsanos et al, 2017;Schlager et al, 2006). LIN-22 codes for a Hairy/Enhancer of Split-related transcription factor, which was found to act in the Wnt pathway by repressing egl-18, a GATA transcription factor, also a repressor of cell fusion in the seam cells (Gorrepati et al, 2013;Katsanos et al, 2017;Wrischnik and Kenyon, 1997). Therefore, variations in not only the inhibitor molecules, but LIN-22 could create noise and variability that leads to stochastic eff-1 expression and cell fusion.…”

A cell fate switch in theC. elegansseam cell lineage occurs through modulation of the Wnt asymmetry pathway in response to temperature increase

“…To construct a pseam::GFP::CAAX::unc-54 transgene, the GFP sequence was amplified using pPD93.65 as template and fused to the following sequence containing the CAAX motif using nested PCR 5’AAGGACGGAAAGAAGAAGAAGAAGAAGTCCAAGACCAAGTGCGTCATCATG3’. The GFP::CAAX fragment was then subcloned into pIR5 (Katsanos et al . 2017) via Gibson assembly.…”