Stable and Transient Expression of Human Coagulation Factor IX in Mammalian Expression Systems; CHO Versus HEK Cells

Vatandoost, Jafar; Dolatabadi, Behnaz

doi:10.5812/gct.13096

Cited by 4 publications

(5 citation statements)

References 19 publications

(26 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…without a fusion protein), deletion of the FIX start codon, and deletion of the FIX signal peptide, did not yield any appreciable signal above that found in parental cell lines. To provide further evidence that proteins displayed using MultiSTEP were properly folded, we focused on factor VIII which has been successfully expressed for therapeutic use in HEK-293 cells 88,89 . Displayed factor VIII robustly bound five monoclonal antibodies directed against the five domains of FVIII ( Supplementary Fig.…”

Section: Resultsmentioning

confidence: 99%

Multiplex, multimodal mapping of variant effects in secreted proteins

Popp,

Powell,

Wheelock

et al. 2024

Preprint

View full text Add to dashboard Cite

Despite widespread advances in DNA sequencing, the functional consequences of most genetic variants remain poorly understood. Multiplexed Assays of Variant Effect (MAVEs) can measure the function of variants at scale, and are beginning to address this problem. However, MAVEs cannot readily be applied to the ~10% of human genes encoding secreted proteins. We developed a flexible, scalable human cell surface display method, Multiplexed Surface Tethering of Extracellular Proteins (MultiSTEP), to measure secreted protein variant effects. We used MultiSTEP to study the consequences of missense variation in coagulation factor IX (FIX), a serine protease where genetic variation can cause hemophilia B. We combined MultiSTEP with a panel of antibodies to detect FIX secretion and post-translational modification, measuring a total of 45,024 effects for 9,007 variants. 49.6% of possible F9 missense variants impacted secretion, post-translational modification, or both. We also identified functional constraints on secretion within the signal peptide and for nearly all variants that caused gain or loss of cysteine. Secretion scores correlated strongly with FIX levels in hemophilia B and revealed that loss of secretion variants are particularly likely to cause severe disease. Integration of the secretion and post-translational modification scores enabled reclassification of ~63% F9 variants of uncertain significance in the My Life, Our Future hemophilia genotyping project. Lastly, we showed that MultiSTEP can be applied to a wide variety of secreted proteins. Thus, MultiSTEP is a multiplexed, multimodal, and generalizable method for systematically assessing variant effects in secreted proteins at scale.

show abstract

Section: Resultsmentioning

confidence: 99%

Multiplex, multimodal mapping of variant effects in secreted proteins

Popp,

Powell,

Wheelock

et al. 2024

Preprint

View full text Add to dashboard Cite

show abstract

“…pcDNA‐FIX encoding for wild‐type human FIX was previously constructed by Vatandoost et al Diagram of pcDNA‐FIX vector was shown in Reference . The cDNA of VKORC1 was PCR‐amplified from a human liver cDNA library with pfu‐DNA polymerase, using oligonucleotide pair VK‐F/KpnI (5'GGGGTACCCGCCGACTACAACTCCCATC3') and VK‐R/XhoI (5' CCGCTCGAGGGGCAATGGAAAGAGCTTTG 3′) as forward/reverse primers.…”

Section: Methodsmentioning

confidence: 99%

Enhanced functional recombinant factor IX production by human embryonic kidney cells engineered to overexpress VKORC1

Pakdaman

Vatandoost

Bos

2019

Biotechnology Progress

Self Cite

View full text Add to dashboard Cite

Replacement therapy with recombinant drugs is the main therapeutic strategy for hemophilia B patients. To reduce the production costs of recombinant coagulation factors, improvement of their expression and activity by enhancement of γ‐carboxylation might be of interest. The expression and functional activity of vitamin K‐dependent (VKD) coagulation proteins rely, in part, on the VKD process of γ‐carboxylation that is mediated by the enzymes γ‐carboxylase and vitamin K epoxide reductase (VKOR). Since the recombinant production of VKD proteins is hampered by the inefficiency of this enzymatic process, we specifically have examined the stable expression of functional blood coagulation factor IX (FIX) in HEK293 cells following transient overexpression of VKORC1 as an important part of VKOR component. Recombinant hFIX‐producing human embryonic kidney (HEK) cells were transfected to overexpress VKORC1. Following reverse transcription polymerase chain reaction (RT‐PCR) analysis, expression efficiency of the active hFIX was analyzed by performing enzyme‐linked immunosorbent assay and coagulation test. In addition, to quantify γ‐carboxylated recombinant FIX, the barium citrate method was used. Overexpression of VKORC1 in FIX‐producing HEK cells, resulting in a 3.2‐fold higher expression of functional FIX, which displayed a 1.4‐fold enhanced specific activity. Moreover, a 3.9‐fold enhanced recovery of fully γ‐carboxylated FIX following barium citrate adsorption was achieved. Collectively, these findings indicate that the overexpression of VKORC1 results in the production of higher levels of functional hFIX in HEK293 cells. The increase of the VKORC1 as a supplier of γ‐carboxylase seems to play a significant role in increasing the amount and efficiency of recombinant FIX production, thereby reducing the production costs.

show abstract

“…The enzyme-linked immunosorbent assay (ELISA) specific for human FIX (Asserachrom hFIX:Ag, Stago, France) and activated partial thromboplastin time (aPTT) reagents were purchased from Diagnostica Stago (Bern, Switzerland). The recombinant human FIX-expressing plasmid, pcDNA-hFIX, which was constructed for the first time in our previous study [3] and resynthesized [4], was used for this study.…”

Section: Methodsmentioning

confidence: 99%

“…The HEK cells were transfected by pcDNA-hFIX plasmid (1 µg/ml), using a calcium phosphate co-precipitation method with few changes. [6] For the assessment of FIX expression in stable clones, the stable HEK-hFIX cells that were already prepared [4] were also seeded separately in a cell factory. In both the transient and stable methods, the FIX expression was screened for five days after addition of 6 µg vitamin K1/ml.…”

Section: Transfection Of Hek Cells and Preparation Of Stable Clonesmentioning

confidence: 99%

Expression of Recombinant Factor IX Using the Transient Gene Expression Technique

Vatandoost

Azimifar

2019

RMM

Self Cite

View full text Add to dashboard Cite

Background: Pilot and large-scale production of recombinant proteins require the presence of stable clones, but the process of selecting stable clones is time consuming. Moreover, continuous clone culturing in large-scale production may cause loss of incoming plasmid and recombinant genes. Considering the advancements in Transient Gene Expression (TGE) technology, the large-scale expression of factor IX (FIX) was investigated in HEK cells by the TGE technique. Materials and Methods: HEK cells were seeded in a cell factory, and then transfected by pcDNA-hFIX plasmid using calcium phosphate co-precipitation method. Stable HEK-hFIX cells were also seeded in a cell factory, separately. After adding vitamin K, recombinant FIX was quantified in conditioned media using an ELISA. Moreover, its functional activity was assayed using an aPTT test. Results: The results showed that the expression and activity of FIX by TGE technology was, respectively, 1.6 and 1.5 times higher than that obtained through stable HEK-FIX cells. Since calculating the specific activity revealed that for all time periods it is 0.2 mU/ng, so the increase in activity is due to the increase in the amount of FIX. Conclusions: HEK cells with higher transfectability seemed to be an appropriate alternative for transient expression for large-scale protein production. Furthermore, if rapid expression of recombinant proteins is intended, TGE can replace costly and low-yield methods.

show abstract

Stable and Transient Expression of Human Coagulation Factor IX in Mammalian Expression Systems; CHO Versus HEK Cells

Cited by 4 publications

References 19 publications

Multiplex, multimodal mapping of variant effects in secreted proteins

Multiplex, multimodal mapping of variant effects in secreted proteins

Enhanced functional recombinant factor IX production by human embryonic kidney cells engineered to overexpress VKORC1

Expression of Recombinant Factor IX Using the Transient Gene Expression Technique

Contact Info

Product

Resources

About