Stabilized β-catenin promotes hepatocyte proliferation and inhibits TNFα-induced apoptosis

Shang, Xian Zhang; Zhu, Haizhen; Lin, Karrie; Tu, Zhengkun; Chen, Jisheng; Nelson, David R.; Liu, Chen

doi:10.1038/labinvest.3700043

Cited by 41 publications

(23 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In prehypertrophic and hypertrophic chondrocytes committed to maturation, ␤-catenin induces terminal differentiation (6,34). The current findings similarly suggest that, in proliferating and immature chondrocytes, ␤-catenin acts downstream of TGF-␤ and functions to stimulate chondrocyte proliferation, consistent with an effect on proliferation in other cell types (37)(38)(39). Thus, a possible explanation of the role of TGF-␤ signaling in modulating Wnt canonical signaling during cell growth versus differentiation is that SMAD3 enhances ␤-catenin signaling during cell proliferation but inhibits signaling in more differentiated chondrocytes progressing toward terminal maturation.…”

Section: Discussionsupporting

confidence: 75%

Transforming Growth Factor-β Stimulates Cyclin D1 Expression through Activation of β-Catenin Signaling in Chondrocytes

Li¹,

Chen²,

et al. 2006

Journal of Biological Chemistry

View full text Add to dashboard Cite

Transforming growth factor-␤ (TGF-␤) plays an essential role in chondrocyte maturation. It stimulates chondrocyte proliferation but inhibits chondrocyte differentiation. In this study, we found that TGF-␤ rapidly induced ␤-catenin protein levels and signaling in murine neonatal sternal primary chondrocytes. TGF-␤-increased ␤-catenin induction was reproduced by overexpression of SMAD3 and was absent in Smad3 ؊/؊ chondrocytes treated with TGF-␤. SMAD3 inhibited ␤-transducin repeat-containing protein-mediated degradation of ␤-catenin and immunoprecipitated with ␤-catenin following TGF-␤ treatment. Both SMAD3 and ␤-catenin co-localized to the nucleus after TGF-␤ treatment. Although both TGF-␤ and ␤-catenin stimulated cyclin D 1 expression in chondrocytes, the effect of TGF-␤ was inhibited with ␤-catenin gene deletion or SMAD3 loss of function. These results demonstrate that TGF-␤ stimulates cyclin D 1 expression at least in part through activation of ␤-catenin signaling.Endochondral bone formation involves condensation and differentiation of mesenchymal cells into chondrocytes, followed by chondrocyte proliferation, maturation, hypertrophic differentiation, and apoptosis. Eventually, the calcified cartilage tissue formed in the growth plate is replaced by bone tissue (1). Each step of the endochondral bone formation process is precisely regulated by local growth factors. Among these factors, transforming growth factor-␤ (TGF-␤) 3 plays important roles in chondrocyte proliferation and hypertrophy. TGF-␤ promotes chondrocyte proliferation but inhibits chondrocyte differentiation and hypertrophy (2-6). The mechanism of TGF-␤-induced chondrocyte proliferation remains undefined.In this study, we investigated the interaction between TGF-␤ and ␤-catenin signaling in chondrocytes. We found that TGF-␤ activates ␤-catenin signaling through SMAD3. SMAD3 interacted with ␤-catenin and increased ␤-catenin nuclear translocation and signaling. Although TGF-␤ stimulated cyclin D 1 expression in chondrocytes, this effect was abolished by inhibition of ␤-catenin signaling. These results demonstrate for the first time that TGF-␤ stimulates cyclin D 1 expression in chondrocytes at least in part through activation of ␤-catenin signaling. These findings provide novel insight regarding the mechanism through which TGF-␤ regulates chondrocyte proliferation. MATERIALS AND METHODS Cell Culture-Smad3Ϫ/Ϫ mice derived from a C57/B6 lineage, in which exon 8 of the Smad3 gene is deleted (a kind gift from Dr. C. X. Deng, National Institutes of Health, Bethesda, MD) (7), were bred using heterozygote pairs. 3-day-old neonatal mice were killed and genotyped using tail tissues obtained at the time of death. The anterior rib cage and sternum were harvested en bloc, washed with sterile phosphate-buffered saline (PBS), and then digested with Pronase (Roche Applied Science) dissolved in PBS (2 mg/ml) in a 37°C water bath with continuous shaking for 60 min. This was followed by incubation in a solution of collagenase D (3 mg/ml dissolved in serum-free Dulbec...

show abstract

Section: Discussionsupporting

confidence: 75%

Transforming Growth Factor-β Stimulates Cyclin D1 Expression through Activation of β-Catenin Signaling in Chondrocytes

Li¹,

Chen²,

et al. 2006

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…35,36 Knockdown of b-catenin gene expression using RNA interference results in cell growth arrest and detachment, whereas stabilization of b-catenin suppresses cell apoptosis. [37][38][39][40][41][42][43] In this study, we have shown that CVB3 infection decreases protein expression of b-catenin via a GSK3b-dependent mechanism, and overexpression of b-catenin inhibits CVB3-induced apoptosis and CPE. These findings suggest b-catenin is a key downstream effector of GSK3b in the regulation of apoptosis and cell morphology.…”

Section: Discussionmentioning

confidence: 99%

Inhibition of glycogen synthase kinase 3β suppresses coxsackievirus-induced cytopathic effect and apoptosis via stabilization of β-catenin

Zhang

Wong

et al. 2005

Cell Death Differ

View full text Add to dashboard Cite

Coxsackievirus B3 (CVB3), a common human pathogen for viral myocarditis, induces a direct cytopathic effect (CPE) and apoptosis on infected cells. To elucidate the mechanisms that contribute to these processes, we studied the role of glycogen synthase kinase 3b (GSK3b). GSK3b activity was significantly increased after CVB3 infection and addition of tyrosine kinase inhibitors blocked CVB3-triggered GSK3b activation. Inhibition of caspase activity had no inhibitory effect on CVB3-induced CPE; however, blockage of GSK3b activation attenuated both CVB3-induced CPE and apoptosis. We further showed that CVB3 infection resulted in reduced b-catenin protein expression, and GSK3b inhibition led to the accumulation and nuclear translocation of b-catenin. Finally, we found that CVB3-induced CPE and apoptosis were significantly reduced in cells stably overexpressing b-catenin. Taken together, our results demonstrate that CVB3 infection stimulates GSK3b activity via a tyrosine kinasedependent mechanism, which contributes to CVB3-induced CPE and apoptosis through dysregulation of b-catenin.

show abstract

“…Protein concentrations were determined from the supernatants using the BioRad Lowry Protein Assay and protein spectrophotometer (750 nm) as previously reported. 16 …”

Section: Materials and Methods Tissue Samplesmentioning

confidence: 99%

“…19 Procedures of RNA and DNA extraction from liver cancer cell lines, PCR, and RT-PCR analysis were previously published. 16 The primers for CPS1 RT-PCR analysis were: 5 0 ATGCGGCCGCAGCCACA AATCATCTTCAAAA; 5 0 CGTCTAGATGAGAAAGTTGTGA ATCAGTTCC, and primers for PCR analysis were 5 0 -CAA CTCAGCATGGCATTGAC; 5 0 -ACAGCTGTCCTCCGAATCAC.…”

Section: Mass Spectrometrymentioning

confidence: 99%

The antigen for Hep Par 1 antibody is the urea cycle enzyme carbamoyl phosphate synthetase 1

Butler

Dong

Cardona

et al. 2008

Laboratory Investigation

Self Cite

116

View full text Add to dashboard Cite

Hepatocyte paraffin 1 (Hep Par 1), a murine monoclonal antibody, is widely used in surgical pathology practice to determine the hepatocellular origin of neoplasms. However, identity of the antigen for Hep Par 1 is unknown. The aim of this study was to characterize the Hep Par 1 antigen. To identify the antigen, immunoprecipitation was used to isolate the protein from human liver tissue, and a distinct protein band was detected at approximately 165 kDa. The protein band was also present in small intestinal tissue, but was not present in several other non-liver tissues nor in three human hepatocellular carcinoma cell lines, Huh-7, HepG2, and LH86. The protein was purified and analyzed by mass spectrometry. It was identified as carbamoyl phosphate synthetase 1 (CPS1). CPS1 is a rate-limiting enzyme in urea cycle and is located in mitochondria. We demonstrated that hepatoid tumors (gastric and yolk sac) were immunoreactive with both Hep Par 1 antibody and anti-CPS1 antibody, further confirming the results of mass spectrometric analysis. We found that the three human hepatocellular carcinoma cell lines do not express either CPS1 RNA or protein. We confirmed that the gene was present in these cell lines, suggesting that suppression of CPS1 expression occurs at the transcriptional level. This finding may have relevance to liver carcinogenesis, since poorly differentiated hepatocellular carcinomas exhibit poor to absent immunoreactivity to Hep Par 1. In conclusion, we have identified the antigen for Hep Par 1 antibody as a urea cycle enzyme CPS1. Our results should encourage further investigation of potential role that CPS1 expression plays in liver pathobiology and carcinogenesis. The histological distinction between hepatocellular carcinomas (HCC) and metastatic adenocarcinoma to the liver can sometimes be a challenging dilemma for surgical pathologists, particularly given the histological variants of HCC that can occur. In addition, tumors in other sites can display hepatoid morphologic features, adding to the diagnostic challenge when considering their metastasis to the liver. In the end, a wide panel of immunohistochemical markers is often used for the differential diagnosis of HCC, cholangiocarcinoma and metastatic adenocarcinoma. These markers include alpha-fetoprotein (AFP), polyclonal carcinoembryonic antigen (pCEA), and alpha-1-antitrypsin.

show abstract

Stabilized β-catenin promotes hepatocyte proliferation and inhibits TNFα-induced apoptosis

Cited by 41 publications

References 42 publications

Transforming Growth Factor-β Stimulates Cyclin D1 Expression through Activation of β-Catenin Signaling in Chondrocytes

Transforming Growth Factor-β Stimulates Cyclin D1 Expression through Activation of β-Catenin Signaling in Chondrocytes

Inhibition of glycogen synthase kinase 3β suppresses coxsackievirus-induced cytopathic effect and apoptosis via stabilization of β-catenin

The antigen for Hep Par 1 antibody is the urea cycle enzyme carbamoyl phosphate synthetase 1

Contact Info

Product

Resources

About