Stability of Reference Genes for Messenger RNA Quantification by Real-Time PCR in Mouse Dextran Sodium Sulfate Experimental Colitis

Abstract

BackgroundMany animal models have been developed to characterize the complexity of colonic inflammation. In dextran sodium sulfate (DSS) experimental colitis in mice the choice of reference genes is critical for accurate quantification of target genes using quantitative real time PCR (RT-qPCR). No studies have addressed the performance of reference genes in mice DSS-experimental colitis. This study aimed to determine the stability of reference genes expression (RGE) in DSS-experimental murine colitis.MethodsColitis was induced in male C57BL/6 mice using DSS5% for 5 days, control group received water. RNA was extracted from inflamed and non-inflamed colon. Using RT-qPCR, comparative analysis of 13 RGE was performed according to predefined criteria and relative colonic TNF-α and IL-1β gene expression was determined by calculating the difference in the threshold cycle.ResultsColitis significantly altered the stability of mucosal RGE. Commonly used glyceraldehyde-3-phosphate dehydrogenase (Gapdh), β-actin (Actb), or β2-microglobulin (β2m) showed the highest variability within the inflamed and control groups. Conversely, TATA-box-binding protein (Tbp) and eukaryotic translation elongation factor 2 (Eef2) were not affected by inflammation and were the most stable genes. Normalization of colonic TNF-α and IL-1β mRNA levels was dependent on the reference gene used. Depending on the genes used to normalize the data, statistical significance varied from significant when TBP / Eef2 were used to non-significant when Gapdh, Actb or β2m were used.ConclusionsThis study highlights the appropriate choice of RGE to ensure adequate normalization of RT-qPCR data when using this model. Suboptimal RGE may explain controversial results from published studies. We recommend using Tbp and Eef2 instead of Gapdh, Actb or β2m as reference genes.

Evaluation of candidate reference genes for RT-qPCR studies in three metabolism related tissues of mice after caloric restriction

“…They are widely used and recognized reference genes, which have been described in the literatures9273031323334 and represent several functional classes to minimize the possibility of co-regulation. The performance of each amplification primer set was tested by RT-qPCR.…”

“…With the help of these statistical algorithms, a number of studies on validation of reference genes have been reported272829. In this study, we performed the first comprehensive study of CR effects in inguinal white adipose tissue (iWAT), skeletal muscle (Sk.M) and liver on twelve commonly-used reference genes involved in different biological functions9273031323334 (Table 1), including the formation of cellular cytoskeleton (beta-actin (Actb) and alpha-tubulin (Tuba)), protein biosynthesis (hydroxymethylbilane synthase (Hmbs), peptidylprolyl isomerase A (Ppia) and ribosomal protein L13A (Rpl13a)), immune response (beta-2 microglobulin (β2m)), metabolism (Gapdh, beta-glucuronidase (Gusb) and phosphoglycerate kinase 1(Pgk1)), nucleotide synthesis (hypoxanthine guanine phosphoribosyl transferase (Hprt)), transcription (TATA box binding protein (Tbp)) and signal transduction (tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta-polypeptide (Ywhaz)). This study provides a basis for the selection of reference genes and useful guidelines for future gene expression studies of CR and metabolism.…”

Dietary salmon milt extracts attenuate hepatosteatosis and liver dysfunction in diet‐induced fatty liver model

“…Real‐time PCR was performed with a CFX 96 Real‐Time PCR Detection System (Bio‐Rad Laboratories Inc., Hercules, CA, USA) using the THUNDERBIRD® SYBR qPCR Mix (Toyobo) according to the manufacturer's instructions. The primers used were: tumor necrosis factor alpha ( Tnfα ) forward primer, 5′‐GGGTGATCGGTCCCCAAAGG ‐3′; Tnfα reverse primer, 5′‐ TTGAGAAGATGATCTGAGTGTGAGG ‐3′; glyceraldehyde‐3‐phosphate dehydrogenase ( gapdh ) forward primer, 5′‐AGGTCGGTGTGAACGGATTTG ‐3′; and gapdh reverse primer, 5′‐GGGGTCGTTGATGGCAACA ‐3′ . The PCR conditions were 95 °C for 60 s, followed by 40 cycles at 95 °C for 15 s and 60 °C for 30 s. The gene expression of Tnfα was normalized to that of GAPDH in each sample.…”

“…The primers used were: tumor necrosis factor alpha (Tnf ) forward primer, 5 ′ -GGGTGATCGGTCCCCAAAGG -3 ′ ; Tnf reverse primer, 5 ′ -TTGAGAAGATGATCTGAGTGTGAGG -3 ′ ; 15 glyceraldehyde-3-phosphate dehydrogenase (gapdh) forward primer, 5 ′ -AGGTCGGTGTGAACGGATTTG -3 ′ ; and gapdh reverse primer, 5 ′ -GGGGTCGTTGATGGCAACA -3 ′ . 16 The PCR conditions were 95 ∘ C for 60 s, followed by 40 cycles at 95 ∘ C for 15 s and 60 ∘ C for 30 s. The gene expression of Tnf was normalized to that of GAPDH in each sample. Data were indicated as relative expression to the HCD group.…”

Semaphorin‐3E attenuates intestinal inflammation through the regulation of the communication between splenic CD11C+ and CD4+CD25− T‐cells

“…Several animal models of IBD have been developed to characterize the molecular mechanisms of the pathophysiology of UC (Raper, ). Dextran sulfate sodium (DSS)‐induced colitis is widely used as an animal model of intestinal injury/repair (Eissa et al, ), as the DSS causes intestinal mucosal injury, exposing CD11c + immune cells of the lamina propria and the spleen (Chassaing, Aitken, Malleshappa, & Vijay‐Kumar, ; Ji et al, ; Munyaka et al, ; Perše & Cerar, ) to various antigens to initiate the inflammatory process.…”