Spry1 Is Expressed in Hemangioblasts and Negatively Regulates Primitive Hematopoiesis and Endothelial Cell Function

Abstract

BackgroundDevelopment of the hematopoietic and endothelial lineages derives from a common mesodermal precursor, the Flk1+ hemangioblast. However, the signaling pathways that regulate the development of hematopoietic and endothelial cells from this common progenitor cell remains incompletely understood. Using mouse models with a conditional Spry1 transgene, and a Spry1 knockout mouse, we investigated the role of Spry1 in the development of the endothelial and hematopoietic lineages during development.Methodology/Principal FindingsQuantitative RT-PCR analysis demonstrates that Spry1, Spry2, and Spry4 are expressed in Flk1+ hemangioblasts in vivo, and decline significantly in c-Kit+ and CD41+ hematopoietic progenitors, while expression is maintained in developing endothelial cells. Tie2-Cre-mediated over-expression of Spry1 results in embryonic lethality. At E9.5 Spry1;Tie2-Cre embryos show near normal endothelial cell development and vessel patterning but have reduced hematopoiesis. FACS analysis shows a reduction of primitive hematopoietic progenitors and erythroblastic cells in Spry1;Tie2-Cre embryos compared to controls. Colony forming assays confirm the hematopoietic defects in Spry1;Tie2-Cre transgenic embryos. Immunostaining shows a significant reduction of CD41 or CD71 and dpERK co-stained cells in Spry1;Tie2-Cre embryos compared to controls, whereas the number of VEC+ and dpERK co-stained cells is comparable. Compared to controls, Spry1;Tie2-Cre embryos also show a decrease in proliferation and an increase in apoptosis. Furthermore, loss of Spry1 results in an increase of CD41+ and CD71+ cells at E9.5 compared with controls.Conclusions/SignificanceThese data indicate that primitive hematopoietic cells derive from Tie2-expressing hemangioblasts and that Spry1 over expression inhibits primitive hematopoietic progenitor and erythroblastic cell development and expansion while having no obvious effect on endothelial cell development.

Fenofibrate Inhibits Cytochrome P450 Epoxygenase 2C Activity to Suppress Pathological Ocular Angiogenesis

“…Total RNA was extracted from retinas or HRMECs using RNeasy Kit (74106, Qiagen, Hilden, Germany), and reverse transcribed using random hexamers and SuperScript III Reverse Transcriptase (Thermo Fisher) according to the manufacturer's instructions(Yang et al, 2011, Yang et al, 2013). Quantitative analysis of gene expression was determined using an ABI Prism 7700 Sequence Detection System (Applied BioSystems) and the SYBR Green Master Mix kit (KK4600, Kapa Biosystems, Wilmington, MA)(He et al, 2014) with primers listed below: CYP2C8 (F: 5′-TGTGGTCCTGGTGCTGTG, R: 5′-ATATTGGGGAATTGCCTCTT), Acox1 (F: 5′- GAGCAGCAGGAGCGTTTCTT, R: 5′- CAGGACTATCGCATGATTGGAAG), Pdk4 (F: 5′- ACAGACATCATAATGTGGTCCCT, R: 5′- GGTCGATACTTCCAATGTGGC), ACOX1 (F: 5′- ACTCGCAGCCAGCGTTATG, R: 5′- AGGGTCAGCGATGCCAAAC), PDK4 (F: 5′-GGAGCATTTCTCGCGCTACA, R: 5′-ACAGGCAATTCTTGTCGCAAA), and Cyclophilin A (F: 5′-AGGTGGAGAGCACCAAGACAGA, R: 5′-TGCCGGAGTCGACAATGAT).…”

Sprouty4 regulates endothelial cell migration via modulating integrin β3 stability through c-Src

“…Ophir Klein (UCSF) generously provided conditional Spry4f/f mice. Conditional overexpression or targeted-deletion of Spry4 in endothelial cells was achieved by mating female CAGGFP-Spry4 or Spry4f/f mice to male VE-cad-Cre or Tie2-Cre mice (Jackson Laboratory) [31]. The resulting bitransgenic and knockout mice were genotyped by polymerase chain reaction as previously described [32].…”

“…Immunoprecipitation and immunoblot analysis was performed and quantified as described [31]. Briefly, for immunoprecipitation, equal amounts of cell lysate were incubated with the indicated antibodies overnight at 4 °C with rotation.…”

Fibroblast Growth Factor Signaling in the Vasculature

“…Injection of a Spry4 adenovirus into mouse embryos disrupted vessel formation in vivo. Overexpression of Spry1 in transgenic mouse embryos results in embryonic lethality due to defects in hematopoiesis and vascular maturation [61]. Gene targeting studies in the mouse show that Spry2 and Spry4 double knockout mice show embryonic lethality by E12.5 due to multiple defects including vascular defects [62].…”