Spotted fever group rickettsia closely related to <i>Rickettsia monacensis</i> isolated from ticks in South Jeolla province, Korea

Lee, Kyung-Min; Choi, Yeon‐Joo; Shin, Sunhye; Choi, Myeon-Song; Hong-tao, Song; Kim, Sang Hyun; Klein, Terry A.; Richards, Allen L.; Park, Kyung-Hee; Jang, Won‐Jong

doi:10.1111/1348-0421.12062

Cited by 34 publications

(24 citation statements)

References 55 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The tick carried a Rickettsia sp., possibly R. monacensis , previously reported from I. ricinus in Germany and other countries in southern Europe as well as from ticks in Korea. R. monacesis has been associated with a Mediterranean spotted-fever like illness in humans [45-47]. The other four infected I. frontalis ticks harboured R. aeschlimannii and infested three birds, two of the ticks infested a Golden Oriole, one came from a Tree-Pipit and one from a Wood Warbler.…”

Section: Discussionmentioning

confidence: 99%

Spotted fever Rickettsia species in Hyalomma and Ixodes ticks infesting migratory birds in the European Mediterranean area

et al. 2014

View full text Add to dashboard Cite

BackgroundA few billion birds migrate annually between their breeding grounds in Europe and their wintering grounds in Africa. Many bird species are tick-infested, and as a result of their innate migratory behavior, they contribute significantly to the geographic distribution of pathogens, including spotted fever rickettsiae. The aim of the present study was to characterize, in samples from two consecutive years, the potential role of migrant birds captured in Europe as disseminators of Rickettsia-infected ticks.MethodsTicks were collected from a total of 14,789 birds during their seasonal migration northwards in spring 2009 and 2010 at bird observatories on two Mediterranean islands: Capri and Antikythira. All ticks were subjected to RNA extraction followed by cDNA synthesis and individually assayed with a real-time PCR targeting the citrate synthase (gltA) gene. For species identification of Rickettsia, multiple genes were sequenced.ResultsThree hundred and ninety-eight (2.7%) of all captured birds were tick-infested; some birds carried more than one tick. A total number of 734 ticks were analysed of which 353 ± 1 (48%) were Rickettsia-positive; 96% were infected with Rickettsia aeschlimannii and 4% with Rickettsia africae or unidentified Rickettsia species. The predominant tick taxon, Hyalomma marginatum sensu lato constituted 90% (n = 658) of the ticks collected. The remaining ticks were Ixodes frontalis, Amblyomma sp., Haemaphysalis sp., Rhipicephalus sp. and unidentified ixodids. Most ticks were nymphs (66%) followed by larvae (27%) and adult female ticks (0.5%). The majority (65%) of ticks was engorged and nearly all ticks contained visible blood.ConclusionsMigratory birds appear to have a great impact on the dissemination of Rickettsia-infected ticks, some of which may originate from distant locations. The potential ecological, medical and veterinary implications of such Rickettsia infections need further examination.

show abstract

Section: Discussionmentioning

confidence: 99%

Spotted fever Rickettsia species in Hyalomma and Ixodes ticks infesting migratory birds in the European Mediterranean area

et al. 2014

View full text Add to dashboard Cite

show abstract

“…A c c e p t e d M a n u s c r i p t 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 (TCGCTCCCCCTAAAGTTATA) designed in the present study for amplification of Candidatus R. tarasevichiae) as well as primer RompA642R for amplification of R. monacensis (Lee et al, 2013). The partial ompB gene was amplified with primers 120-2788F and 129-3599 (Roux and Raoult 2000).…”

Section: Page 5 Of 17mentioning

confidence: 97%

Detection and identification of Rickettsia species in Ixodes tick populations from Estonia

Katargina

Geller

Ivanova

et al. 2015

Ticks and Tick-borne Diseases

View full text Add to dashboard Cite

“…Recently, a case of R. monacensis infection in humans was reported in a resident of Spain (12) and subsequent cases were reported in Italy and the Netherlands (13,14). More recently, R. monacensis was detected and isolated from Ixodes ticks in Korea (15,16).…”

mentioning

confidence: 99%

First isolation of Rickettsia monacensis from a patient in South Korea

Kim

Choi

Lee

et al. 2017

Microbiology and Immunology

Self Cite

View full text Add to dashboard Cite

A Rickettsia sp. was isolated from the blood of a patient with an acute febrile illness using the shell vial technique; the isolate was named CN45Kr and was identified by molecular assay as Rickettsia monacensis, which was first recognized as a pathogen in Spain. Sequencing analysis showed that the gltA sequence of the isolate was identical to that of Rickettsia sp. IRS3. The ompA-5mp fragment sequence showed 100% identity to those of R. monacensis and Rickettsia sp. In56 and ompA-3pA In56 and 100% identity to that of Rickettsia sp. IRS3. The ompB sequence was found to have 99.9% similarity to that of R. monacensis IrR/Munich. This study confirms the pathogenicity of this agent and provides additional information about its geographic distribution.

show abstract

Spotted fever group rickettsia closely related to Rickettsia monacensis isolated from ticks in South Jeolla province, Korea

Cited by 34 publications

References 55 publications

Spotted fever Rickettsia species in Hyalomma and Ixodes ticks infesting migratory birds in the European Mediterranean area

Spotted fever Rickettsia species in Hyalomma and Ixodes ticks infesting migratory birds in the European Mediterranean area

Detection and identification of Rickettsia species in Ixodes tick populations from Estonia

First isolation of Rickettsia monacensis from a patient in South Korea

Contact Info

Product

Resources

About