Sphingosine-1-phosphate Phosphatase 2 Regulates Pancreatic Islet β-Cell Endoplasmic Reticulum Stress and Proliferation

Abstract

Sphingosine-1-phosphate (S1P) is a sphingolipid metabolite that regulates basic cell functions through metabolic and signaling pathways. Intracellular metabolism of S1P is controlled, in part, by two homologous S1P phosphatases (SPPases), 1 and 2, which are encoded by the Sgpp1 and Sgpp2 genes, respectively. SPPase activity is needed for efficient recycling of sphingosine into the sphingolipid synthesis pathway. SPPase 1 is important for skin homeostasis, but little is known about the functional role of SPPase 2. To identify the functions of SPPase 2 in vivo, we studied mice with the Sgpp2 gene deleted. In contrast to Sgpp1 ؊/؊ mice, Sgpp2 ؊/؊ mice had normal skin and were viable into adulthood. Unexpectedly, WT mice expressed Sgpp2 mRNA at high levels in pancreatic islets when compared with other tissues. Sgpp2 ؊/؊ mice had normal pancreatic islet size; however, they exhibited defective adaptive ␤-cell proliferation that was demonstrated after treatment with either a high-fat diet or the ␤-cell-specific toxin, streptozotocin. Importantly, ␤-cells from untreated Sgpp2 ؊/؊ mice showed significantly increased expression of proteins characteristic of the endoplasmic reticulum stress response compared with ␤-cells from WT mice, indicating a basal islet defect. Our results show that Sgpp2 deletion causes ␤-cell endoplasmic reticulum stress, which is a known cause of ␤-cell dysfunction, and reveal a juncture in the sphingolipid recycling pathway that could impact the development of diabetes.Sphingosine 1-phosphate (S1P) 3 is a potent bioactive lipid produced from the degradation of plasma membrane sphingolipids (1-3). As a signaling molecule, S1P exerts effects in a variety of biological processes through interactions with both extracellular receptors and intracellular targets. As an intracellular metabolic intermediate, S1P is readily metabolized to other bioactive sphingolipids, such as ceramide and sphingosine, as well as to other lipids (Fig. 1A). S1P and its metabolites control basic cell functions, such as proliferation, apoptosis, and migration, and are involved in several pathologic conditions, including inflammation, metabolic disease, and cancer (1, 2). Thus, insight into S1P metabolism and how this regulates its functional activity is of key importance in understanding the role of S1P in biology and disease. S1P is produced by the sphingosine kinase-dependent phosphorylation of sphingosine, which is created as a degradation product of ceramide (4). Within cells, S1P is degraded through two pathways, either by irreversible cleavage by S1P lyase (5) or by dephosphorylation by specific S1P phosphatases (SPPases) (also known as S1P phosphohydrolases) (6). When cleaved by S1P lyase (Sgpl1), phosphoethanolamine and hexadecenal are produced, which are then transferred as substrates from the sphingolipid pathway to the glycerophospholipid pathway.In an alternative catabolic route catalyzed by S1P phosphatases, the resulting sphingosine product can be derivatized with a fatty acid by ceramide synthase to produce cer...

Overexpression of sphingosine-1-phosphate lyase protects insulin-secreting cells against cytokine toxicity

“…We observed a reduced cytokine-mediated caspase-3 activation and proliferation inhibition in INS1E-SPL cells, whereas spl knockdown potentiated cytotoxic effects of cytokines. Our data are in accordance with results in the mouse knockout model of Spp2, the enzyme dephosphorylating S1P to sphingosine SPL in insulin-secreting cells (hence decreasing the S1P intracellular concentration), in which a worsening of ␤-cell function was reported (50). Interestingly, SPL overexpression resulted in a parallel 2-fold reduction of the proapoptotic sk2 expression, 7 an effect that might be mediated by reduced S1P availability for inhibition of HDAC1/2 (13, 51) by SPL overexpression.…”

“…In the present study, we showed that SPL overexpression resulted in a reduction of chop and an increase of bip expression upon cytokine exposure. Reduction of cytokine-mediated ER stress by SPL overexpression is in line with the observation made in the Spp2 knockout mice, where increased intracellular S1P levels correlated with a stronger activation of ER stress in pancreatic ␤-cells (50). SPL deficiency participates in the development and progression of immune and neurological disorders, cancer as well as lung and heart inflammation (27, 30 -32, 34, 62).…”

Hesperidin modulates dextran sulfate sodium‐induced ulcerative colitis in rats: Targeting sphingosine kinase‐1‐ sphingosine 1 phosphate signaling pathway, mitochondrial biogenesis, inflammation, and apoptosis

“…Interestingly, Sgpp2 deficiency, suppressed UC induced apoptosis and improved mucosal integrity . Hesperidin decreased levels of SphK1 and Sgpp2 expression confirming its anti‐inflammatory and antiapoptotic role . SphK1/S1P pathway induction plays a critical role in TNF‐α induced activation of NF‐kB, which regulates expression of the important proinflammatory cytokines and chemokines including MIP1‐α.…”

“…Also, diarrhea could be due to hyperosmolarity in the colonic lumen and/or increased intestinal cell permeability caused by DSS . Hesperidin treatment ameliorated body weight loss, colonic weight/length ratio, and DAI, which may be attributed to its anti‐inflammatory effects and its ability to restore metabolism and cellular biosynthesis . Colonic Sgpp2 mRNA expression and SphK1 levels were increased in the UC group.…”

“…A control reaction without a DNA template was performed in parallel to detect genomic DNA contamination. The mouse‐specific Sgpp2 primers used were designed according to Taguchi et al as follows: forward: (5′‐CTATTACCTGTTCCGGTTTTCAGC‐3′) and reverse: (5′‐CTCTTTTCAAGTCTCACAACGGG‐3′); primers for GAPDH as internal control were as follows: forward: (5′‐GGTGAAGTTCGGAGTCAACGGA‐3′) and reverse primer: (5′‐GAGGGATCTCGCTCCTGGAAGA‐3′) (GenBank Accession No. NM_017008).…”