Sphingosine 1-phosphate acts as a signal molecule in ceramide signal transduction of TNF-.ALPHA.-induced activator protein-1 in osteoblastic cell line MC3T3-E1 cell

Takeshita, Akira; Shinoda, Hiroyuki; Nakabayashi, Y; Takano, Akiko; Matsumoto, Ken; Suetsugu, Mayumi; Miyazawa, Kei; Tanaka, Sonoji; Endo, Hiromasa; Tanaka, Susumu; Ueyama, Yuya; Hanzawa, Akiko; Suda, Yoko; Kanegae, Haruhide; Yasui, Toshikazu

doi:10.2334/josnusd.47.43

Cited by 7 publications

(11 citation statements)

References 52 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Because excessive production of proinflammatory cytokines by activated cardiac myocytes can cause heart failure, we sought to determine whether luteolin also regulates cardiac myocytes production of an inflammatory cytokine, TNF-α, which is known to play a critical role in the inflammatory processes. Since LPS challenge induces a large increase in myocardial TNF-α production [6], in this study, we have tested the ability of luteolin to inhibit LPS-induced myocardial TNF-α expression. Using freshly isolated neonatal rat primary cardiomyocytes, we show here, to our knowledge for the first time, that luteolin inhibits LPS-induced TNF-α expression.…”

Section: Discussionmentioning

confidence: 99%

“…Electrophoretic mobility shift assay (EMSA) assay was performed as described previously with modification [6]. Nuclear extracts (4 μg) were incubated with 1 pmol of biotin end-labeled NF-κB consensus oligonucleotides (AGTTGAGGGGACTTTCCCAGGC) (Promega) in 20 μL of binding mixture for 20 min at room temperature.…”

Section: Electrophoretic Mobility Shift Assaymentioning

confidence: 99%

“…NF-κB is a transcription factor which, under basal conditions, is sequestered as an inactive form in the cytoplasm through its interaction with inhibitory protein (IκBs). LPS activates the NF-κB signaling pathway, resulting in the proteasome-mediated degradation of IκB and subsequent translocation of NF-κB to the nucleus, where it binds to specific sequences in the promoter region of genes such as TNF-α [4,6,7]. NF-κB activation plays a critical role in LPS-induced TNF-α production in cardiomyocytes [4].…”

Section: Introductionmentioning

confidence: 98%

“…The induction of TNF-α production in cardiomyocytes under pathological condition was involved in the activation of the NF-κB signaling pathway [6]. NF-κB is a transcription factor which, under basal conditions, is sequestered as an inactive form in the cytoplasm through its interaction with inhibitory protein (IκBs).…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Luteolin Prevents LPS-Induced TNF-α Expression in Cardiac Myocytes Through Inhibiting NF-κB Signaling Pathway

Zhang

et al. 2010

Inflammation

View full text Add to dashboard Cite

Luteolin, a plant flavonoid, has been shown to suppress inflammatory responses; however, the mechanism of luteolin on cardiac myocyte inflammation is still unknown. Because tumor necrosis factor-α (TNF-α), an inflammatory cytokine, is elevated in the failing heart and exerts multiple potentially harmful effects on cardiac myocytes, we therefore sought to examine the effects of luteolin on the expression of TNF-α in neonatal rat cardiac myocytes. In the present study, enzyme-linked immunosorbent assay (ELISA), real-time PCR, immunoblot, immunochemistry staining, and electrophoretic mobility shift assays (EMSA) were performed. ELISA assay showed that luteolin decreased lipopolysaccharide (LPS)-induced production of TNF-α in the medium. Real-time PCR assay confirmed that luteolin also inhibited LPS-induced increase in TNF-α mRNA in myocytes. Furthermore, immunoblot and immunochemistry staining assays represented that luteolin blocked LPS-induced IκB-β degradation and NF-κB p65 subunit nuclear translocation. In addition, EMSA demonstrated that luteolin reduced LPS-induced NF-κB DNA binding activity. Luteolin protects against LPS-induced TNF-α expression via inhibition of the NF-κB signaling pathway, suggesting that luteolin may be a potential therapeutic agent for the treatment of inflammation-related myocardial diseases.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Electrophoretic Mobility Shift Assaymentioning

confidence: 99%

Section: Introductionmentioning

confidence: 98%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Luteolin Prevents LPS-Induced TNF-α Expression in Cardiac Myocytes Through Inhibiting NF-κB Signaling Pathway

Zhang

et al. 2010

Inflammation

View full text Add to dashboard Cite

show abstract

“…Moreover, reduction of c-Fos activity by antisense oligonucleotides can prevent growth factor-deprived lymphoid cells from undergoing apoptosis. Since TNF-α and other cytokines rise apparently in VMC (Glück et al, 2001;Calabrese et al, 2004;Reifenberg et al, 2007), isoproterenol, TNF-α and other cytokines induce expression of c-Fos oncogene (Haliday et al, 1991;Emch et al, 2001;Ono et al, 2004;Takeshita et al, 2005), Zhang et al (2010) have made observations of abnormal expression of c-Fos in VMC, and in the cardiomyocyte of VMC mice they found an increase of the expression of c-Fos, and that c-Fos is able to produce AP-1 with products of c-jun gene. In addition, they have tried to use c-Fos McAb as an experimental treatment method to treat the VMC mice, and ultimately found a significant decrease of myocardial necrosis and cell infiltration.…”

Section: Monoclonal Antibody Therapy Against Apoptosismentioning

confidence: 99%

Advances in monoclonal antibody application in myocarditis

Han

Wang

et al. 2013

J. Zhejiang Univ. Sci. B

View full text Add to dashboard Cite

Abstract:Monoclonal antibodies have become a part of daily preparation technologies in many laboratories. Attempts have been made to apply monoclonal antibodies to open a new train of thought for clinical treatments of autoimmune diseases, inflammatory diseases, cancer, and other immune-associated diseases. This paper is a prospective review to anticipate that monoclonal antibody application in the treatment of myocarditis, an inflammatory disease of the heart, could be a novel approach in the future. In order to better understand the current state of the art in monoclonal antibody techniques and advance applications in myocarditis, we, through a significant amount of literature research both domestic and abroad, developed a systematic elaboration of monoclonal antibodies, pathogenesis of myocarditis, and application of monoclonal antibodies in myocarditis. This paper presents review of the literature of some therapeutic aspects of monoclonal antibodies in myocarditis and dilated cardiomyopathy to demonstrate the advance of monoclonal antibody application in myocarditis and a strong anticipation that monoclonal antibody application may supply an effective therapeutic approach to relieve the severity of myocarditis in the future. Under conventional therapy, myocarditis is typically associated with congestive heart failure as a progressive outcome, indicating the need for alternative therapeutic strategies to improve long-term results. Reviewing some therapeutic aspects of monoclonal antibodies in myocarditis, we recently found that monoclonal antibodies with high purity and strong specificity can accurately act on target and achieve definite progress in the treatment of viral myocarditis in rat model and may meet the need above. However, several issues remain. The technology on how to make a higher homologous and weak immunogenic humanized or human source antibody and the treatment mechanism of monoclonal antibodies may provide solutions for these open issues. If we are to further stimulate progress in the area of clinical decision support, we must continue to develop and refine our understanding and use of monoclonal antibodies in myocarditis.

show abstract

The Effect of c-fos on Acute Myocardial Infarction and the Significance of Metoprolol Intervention in a Rat Model

Zhang

Goldstein

et al. 2012

Cell Biochem Biophys

View full text Add to dashboard Cite

Over-expression of c-fos may play a role in some diseases. Research pertaining to the expression of c-fos in acute myocardial ınfarction (AMI) is rare, and the detailed role of c-fos in AMI has not been reported. Therefore, the purpose of this project was to elucidate the detailed effect of c-fos on AMI rats and evaluate the effect of a metoprolol intervention. An AMI rat model was established for the purposes of this study. The expression of c-fos in AMI was evaluated via immunohistochemical analysis and in situ hybridization. Simultaneously, we investigated the effect of c-fos on AMI rats via medicinal treatment with c-fos monoclonal antibody, isoproterenol, and metoprolol. Positive c-Fos protein expression and c-fos mRNA expression in cardiomyocytes were increased at 1, 3, 7, and 10 days after ligation in AMI rats compared with a sham-operated group. Peak expression occurred at 3 days after ligation. The weight percentage fraction of infarct size was decreased in rats treated with c-fos monoclonal antibody compared with the control normal saline treatment group. The weight percentage fraction of infarction size was increased after c-fos was increased via the administration of isoproterenol. c-Fos protein expression and the infarct size in rats treated with metoprolol were also decreased compared with the control normal saline treatment group. The results showed that c-fos expression rapidly increased after coronary ligation; c-fos plays an important role in myocardial lesions and is likely to be involved in the pathogenesis of AMI as well. Metoprolol can inhibit the expression of c-fos and has a positive therapeutic effect on rats after AMI; the involvement effect of metoprolol on myocardial infarction might be correlated with its effect on the inhibition of c-fos.

show abstract

Sphingosine 1-phosphate acts as a signal molecule in ceramide signal transduction of TNF-.ALPHA.-induced activator protein-1 in osteoblastic cell line MC3T3-E1 cell

Cited by 7 publications

References 52 publications

Luteolin Prevents LPS-Induced TNF-α Expression in Cardiac Myocytes Through Inhibiting NF-κB Signaling Pathway

Luteolin Prevents LPS-Induced TNF-α Expression in Cardiac Myocytes Through Inhibiting NF-κB Signaling Pathway

Advances in monoclonal antibody application in myocarditis

The Effect of c-fos on Acute Myocardial Infarction and the Significance of Metoprolol Intervention in a Rat Model

Contact Info

Product

Resources

About