Specific fluorescent labeling of two functional domains in RNA polymerase α subunit

Abstract

A monomercury derivative of fluoresceine acetate (FMMA) was previously suggested as a specific reagent reacting with only one of four cysteine (Cys) residues in the alpha. subunit of Escherichia coli RNA polymerase. Here, we analyzed the reactivity against FMMA of both isolated alpha subunit and alpha subunit assembled in the holoenzyme. In both cases, the highest reactivity was identified for Cys-269 positioned in the regulatory helix of C-terminal domain (CTD) which includes the contact sites for both class-I transcription factors and DNA UP elements. Substitution of Ala for both Cys-269 and Cys-176 completely eliminates the reactivity of alpha subunit against the fluorescent dye, supporting the prediction that another reactive amino acid under native conformation is Cys-176, which is positioned within or near the region important for alpha dimerization and its binding of beta' subunit. In the isolated alpha subunit, the reactivity against FMMA is different between these two Cys residues and the order is from Cys-269 to Cys-176. Mutant alpha-subunits, bearing only one Cys residue at either 269 or 176, could be reconstituted into locally modified and active enzymes. This FMMA modification system may provide a tool suitable for studies of intra- and intermolecular interactions of this subunit.

Transcription Activation Mediated by the Carboxyl-terminal Domain of the RNA Polymerase α-Subunit

“…One mutant, bearing the single Cys residue at its native position, 269, was constructed previously (17,18), whereas seven were prepared in this study by the overlapping polymerase chain reaction mutagenesis method (22). Two synthetic oligonucleotides (CGGAAGAAGATGAGCGCCCAAT-CGG and CCGTCTGCTGGTGACGCATGCTACAGCCCT) were used as forward primers, and seven species of oligonucleotides (GCTTGCGAA-ACGCGGGCCCAGTTCG, GCGTTAGCAGAGCGGAC(GCA)CAATTC-CAGATCGT (T263C), GGATAGCTTCTGC(GCA)AAGAGCGTTAGCA-GAGCGGA (L271C), GTGGATAGCTTC(GCA)TTTAAGAGCGTTAGC-AGAGCGG (A272C), GCTCAACCTCGGTACG(GCA)TACCAGATCAC-CGA (Q283C), GGAGCTCAACCTC(GCA)ACGCTGTACCAGA (T285C), CCAAGGTTAGG(GCA)TTTAAGGAGCTCAACCT (T292C), and GAG-ACAGTCCACG(GCA)AGCCAGCACG (S309C) were used as reverse primers.…”

“…Modification of Mutant ␣-Subunits with FMA-The synthesis and spectral and chemical characteristics of FMA are described elsewhere (17,24,25). Since a mercaptide bond is unstable in the presence of thiol compounds, DTT was removed from all protein samples by gel filtration through a Sephadex G-50 column (1 ϫ 8 cm).…”

“…Previously, we constructed the single Cys mutant ␣-subunit derivative bearing Cys only at its natural position, 269 (17). In addition, we constructed in this study a set of mutant ␣-subunit derivatives carrying a single Cys residue after replacement by Cys of Thr-263, Lys-271, Ala-272, Gln-283, Thr-285, Thr-292, or Ser-309, starting with the Cys-null ␣-subunit mutant possessing all four Cys residues substituted with Ala (C54A, C131A, C176A, and C269A) (17).…”

“…In addition, we constructed in this study a set of mutant ␣-subunit derivatives carrying a single Cys residue after replacement by Cys of Thr-263, Lys-271, Ala-272, Gln-283, Thr-285, Thr-292, or Ser-309, starting with the Cys-null ␣-subunit mutant possessing all four Cys residues substituted with Ala (C54A, C131A, C176A, and C269A) (17). The site of Cys substitution was chosen so as to preserve the activities of the ␣-subunit by avoiding mutagenesis of amino acid residues generally crucial for biological activities and by replacing amino acid residues that are similar in chemical nature to Cys (with the exception of Lys-271).…”

“…For this purpose, a set of single Cys mutant ␣-subunits at residues 263, 271, 272, 283, 285, 292, and 309 was constructed in addition to the Cys-269 mutant that was used in our previous studies (17,18), and a fluorescent probe, fluorescein mercuric acetate (FMA), was conjugated to each of the single Cys mutant ␣-subunits. Using the reconstituted RNA polymerase holoenzymes containing the FMA-tethered mutant ␣-subunits, the fluorescent spectral changes were monitored after complex formation with the CRPdependent promoter uxuAB, the factor-independent promoter T7D, and the UP element-dependent promoter rrnBP1.…”