Specific binding of lipopolysaccharides to mouse macrophages—II. Involvement of distinct lipid a substructures

Tahri-Jouti, Mohamed-Ali; Mondange, Michelle; Dur, Annick Le; Auzanneau, France‐Isabelle; Charon, Daniel; Girard, Robert; Chaby, Richard

doi:10.1016/0161-5890(90)90085-e

Cited by 26 publications

(14 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The LPS from Bordetella pertussis (LPS-Bp) and the lipid A fraction of the latter (BpLA), were prepared as described previously (Tahri-Jouti et al, 1990). The LPS from Rhizobium species Sin-1 ('rough' chemotype) and its lipid A fragment, were provided by R. W. Carlson (University of Georgia, Athens, GA).…”

Section: Lipopolysaccharides and Lipid Amentioning

confidence: 99%

Lipopolysaccharides fromLegionellaandRhizobiumstimulate mouse bone marrow granulocytes via Toll-like receptor 2

Girard

Pédron

Uematsu

et al. 2003

Journal of Cell Science

Self Cite

136

122

View full text Add to dashboard Cite

Lipopolysaccharide (LPS) derived from enterobacteria elicit in several cell types cellular responses that are restricted in the use of Toll-like receptor 4 (TLR4) as the principal signal-transducing molecule. A tendency to consider enterobacterial LPS as a prototypic LPS led some authors to present this mechanism as a paradigm accounting for all LPSs in all cell types. However, the structural diversity of LPS does not allow such a general statement. By using LPSs from bacteria that do not belong to the Enterobacteriaceae, we show that in bone marrow cells (BMCs) the LPS of Rhizobium species Sin-1 and of three strains of Legionella pneumophila require TLR2 rather than TLR4 to elicit the expression of CD14. In addition, exposure of BMCs from TLR4-deficient (C3H/HeJ) mice to the lipid A fragment of the Bordetella pertussis LPS inhibits their activation by the Legionella lipid A. The data show selective action of different LPSs via different TLRs, and suggest that TLR2 can interact with many lipid A structures, leading to either agonistic or specific antagonistic effects.

show abstract

Section: Lipopolysaccharides and Lipid Amentioning

confidence: 99%

Lipopolysaccharides fromLegionellaandRhizobiumstimulate mouse bone marrow granulocytes via Toll-like receptor 2

Girard

Pédron

Uematsu

et al. 2003

Journal of Cell Science

Self Cite

136

122

View full text Add to dashboard Cite

show abstract

“…LPS from Salmonella typhimurium (Difco Laboratories) and re-purified by the classical phenol/water method (26). Phosphothioate-CpG (ODN 1826: TCCATGACGTTCCTGACGTT) was synthesized by Invitrogen.…”

Section: Reagentsmentioning

confidence: 99%

The Bw Cells, a Novel B Cell Population Conserved in the Whole Genus Mus

Thiriot

Drapier

Fitting

et al. 2007

The Journal of Immunology

View full text Add to dashboard Cite

In common laboratory mouse strains, which are derived from the crossing between three subspecies, peritoneal B cells are enriched in B-1a cells characterized by the CD5+Mac-1+B220lowIgMhighIgDlowCD43+CD9+ phenotype. Intriguingly in other vertebrates, CD5+Mac-1+ cells have never been found in a specific anatomic site. To ascertain the peculiarity of the CD5+ peritoneal B cells in laboratory mice, we analyzed the peritoneal B cell subsets in 9 inbred and 39 outbred wild-derived mouse strains belonging to 13 different species/subspecies. We found that most of these strains do not have the CD5+ B-1a cell population. However, all of these strains including classical laboratory mouse strains, have variable proportions of a novel B cell population: Bw, which is characterized by a unique phenotype (CD5−Mac-1+B220highIgMhighIgDhighCD43−CD9−) and is not restricted to the peritoneal cavity. Bw cells are also distinct from both B-1 and B-2 cells from a functional point of view both by proliferative responses, cytokine secretion and Ab synthesis. Moreover, transfer experiments show that bone marrow and fetal liver cells from wild mice can give rise to Bw cells in alymphoid mice. The conservation of this B cell population, but not of the CD5+ B-1a, during evolution of the genus Mus, its readiness to respond to TLR ligands and to produce high concentration of autoantibodies suggest that Bw cells play a key role in innate immunity.

show abstract

“…The LPSs from S. enterica serovar choleraesuis (LPS-Sc), from S. enterica serovar senftenberg (LPS-Ss), and from Bordetella pertussis (LPS-Bp), and the lipid A fraction of the latter, were prepared as described previously (20,21). The LPSs from Rhizobium species Sin-1, Rhizobium galegae, and Rhizobium leguminosarum biovar trifolii 24AR were provided by Dr. R. W. Carlson (University of Georgia, Athens, GA).…”

Section: Animals and Cell Culture-c57bl/10mentioning

confidence: 99%

TLR4-dependent Lipopolysaccharide-induced Shedding of Tumor Necrosis Factor Receptors in Mouse Bone Marrow Granulocytes

Pédron

Girard

Chaby

2003

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

We reported previously that bone marrow granulocytes respond to small amounts of enterobacterial lipopolysaccharide (LPS) via a CD14-independent and TLR4-mediated mechanism by de novo expression of an inducible receptor (CD14) and by down-modulation of a constitutive receptor (L-selectin). In this report we address another effect of LPS: the down-regulation of receptors for tumor necrosis factor-␣. In mouse bone marrow cells (BMC), this down-regulation is detectable soon (20 min) after exposure of the cells to low levels (0.5 ng/ml) of LPS. This temperature-dependent effect is rather selective for LPS and requires the presence of a conventional lipid A structure in the LPS molecule and a functional TLR4 molecule in the cells. The down-modulation, due to a shedding of the receptors, is blocked by p38 MAPK inhibitors, by a furin inhibitor, and by three metalloproteinase inhibitors (BB-3103, TIMP-2, and TIMP-3). In contrast, inhibitors of MEK, protein kinase C, cAMP-dependent protein kinase, and kinases of the Src family do not block the shedding. Analysis of BMC from mice lacking tumor necrosis factor receptor-1 (CD120a ؊/؊ ) or tumor necrosis factor receptor-2 (CD120b ؊/؊ ) indicates that the LPS-induced shedding is specific for CD120b. Thus, exposure of BMC to LPS triggers a rapid shedding of CD120b via a protein kinase Cand Src-independent pathway mediated by p38 MAPK, furin, and metalloproteinase. The additive effects of furin and metalloproteinase inhibitors suggest that these enzymes are involved in parallel shedding pathways.Two major cell types, the neutrophilic granulocyte and the monocyte/macrophage, are associated with susceptibility to infections (1). Both derive from granulocyte-type progenitor cells present in the bone marrow. Therefore, a better knowledge of the events following the interaction of bacterial lipopolysaccharide (LPS) 1 with bone marrow granulocytes can help us to understand some of its in vivo effects. We have shown in a previous study (2) that granulocytes from the bone marrow of LPS-responsive mice express an inducible LPS-binding site on their cell surface after exposure in vivo or in vitro to nanomolar concentrations of LPS. This cell surface molecule was identified later as CD14 (3, 4). In contrast to this expression of a receptor, many surface markers are actually down-modulated after exposure of cells to LPS. This has been observed in macrophages with mannose receptors (5), scavenger receptors (6), interleukin 6 receptors (7), CSF-M receptors (8), and TNF-␣ receptors (TNF-R) (9). Concerning BMC, we found in a previous study (10) that LPS induced in these cells a marked down-regulation of TNF-R, in the absence of any direct binding of LPS to TNF-R. Because TNF-␣ and its receptors play a prominent role in inflammation and in LPS-induced septic shock (11, 12), we considered that the mechanism by which LPS induces the down-regulation of TNF-R in BMC would deserve closer scrutiny. The two known TNF-␣ receptors CD120a (p55) and CD120b (p75) have gained wide interest because of their ...

show abstract

Specific binding of lipopolysaccharides to mouse macrophages—II. Involvement of distinct lipid a substructures

Cited by 26 publications

References 22 publications

Lipopolysaccharides fromLegionellaandRhizobiumstimulate mouse bone marrow granulocytes via Toll-like receptor 2

Lipopolysaccharides fromLegionellaandRhizobiumstimulate mouse bone marrow granulocytes via Toll-like receptor 2

The Bw Cells, a Novel B Cell Population Conserved in the Whole Genus Mus

TLR4-dependent Lipopolysaccharide-induced Shedding of Tumor Necrosis Factor Receptors in Mouse Bone Marrow Granulocytes

Contact Info

Product

Resources

About