Species diversity of the marine diatom genus Skeletonema in Japanese brackish water areas

Yamada, Masatoshi; Otsubo, Mayuko; Tsutsumi, Yuki; Mizota, Chiaki; Iida, Naoki; Okamura, Kazuma; Kodama, Masashi; Umehara, Akira

doi:10.1007/s12562-013-0671-0

Cited by 16 publications

(10 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…S. tropicum has been isolated primarily from subtropical waters, including the Gulf of Mexico . The diversity of Skeletonema observed in NBay is similar to that found in coastal waters around Japan, where up to 11 species have been identified using cloning and sequencing techniques (Yamada et al 2010, Yamada et al 2013, Yamada et al 2014. This is in stark contrast to previous studies of Skeletonema in other regions, such as the Skagerrak− Kattegat and Baltic Sea, showing that S. marinoi appears to be the sole representative of the genus there (e.g.…”

Section: Seasonal Variation In Skeletonema Community Compositionsupporting

confidence: 65%

Temporal variation of Skeletonema community composition from a long-term time series in Narragansett Bay identified using high-throughput DNA sequencing

Canesi¹,

Rynearson²

2016

Mar. Ecol. Prog. Ser.

View full text Add to dashboard Cite

Section: Seasonal Variation In Skeletonema Community Compositionsupporting

confidence: 65%

Temporal variation of Skeletonema community composition from a long-term time series in Narragansett Bay identified using high-throughput DNA sequencing

Canesi¹,

Rynearson²

2016

Mar. Ecol. Prog. Ser.

View full text Add to dashboard Cite

“…Interestingly, the rDNA sequences of S. potamos were identical to those of S. subsalsum (strain FCH024) collected from tidal water of the Chikugo River, Japan (Yamada et al . ). Yamada et al .…”

Section: Introductionmentioning

confidence: 97%

Utility of mitochondrial‐encoded cytochrome c oxidase I gene for phylogenetic analysis and species identification of the planktonic diatom genus Skeletonema

Yamada

Otsubo

Tsutsumi

et al. 2017

Phycological Research

Self Cite

View full text Add to dashboard Cite

SUMMARY Small subunit (SSU) and large subunit (LSU) rDNA sequences have been commonly used to delineate the taxonomy and biogeography of the planktonic diatom genus Skeletonema, but the genes occur as multiple copies and are therefore not suitable for barcoding purposes. Here, we analyzed phylogenetic relationships of Skeletonema using the mitochondrial‐encoded cytochrome c oxidase I gene (cox1), as well as partial LSU rDNA (D1–D3) and SSU rDNA, to identify the factors that define species and to evaluate the utility of these three markers for this taxon. Twelve Skeletonema species were divided into six clades, I–VI, each of which comprised the same species by the three markers: clades I (S. japonicum, S. grethae, S. pseudocostatum, and S. tropicum), II (S. menzelii), III (S. dohrnii and S. marinoi), IV (S. costatum, S. potamos, and S. subsalsum), V (S. grevillei), and VI (S. ardens). However, the branching order among these clades was incongruent among the markers. In clade III, six S. marinoi strains had identical cox1 sequences. These S. marinoi strains branched along with S. dohrnii, except for strains from the Gulf of Naples, with high support in cox1. Species delimitation between S. dohrnii and S. marinoi was therefore not supported. In clade IV, S. costatum and S. subsalsum were robustly clustered, with S. potamos as a sister clade in the cox1 tree, not in the LSU and SSU trees. In clade II, cox1 also confirmed that S. menzelii includes three subclades potentially distinguishable from each other by morphological features. Cox1 proved to be the most useful marker for the identification of Skeletonema species because it gave a tree with highly supported clades, has sufficient variation within and among species, encodes a protein in a single copy, and requires relatively few primers.

show abstract

“…PCR products were sequenced with the same primer set and a second primer pair (LSU 277–F: 5′‐CACCGATAGTGTACAAGTACCG‐3′ and LSU 549R–R: 5′‐CACAGAGTGACTGACCTCAGC‐3′; Yamada et al. ), also designed for LSU. Sequences of strains isolated in this study were deposited in the DNA Data Bank of Japan.…”

Section: Methodsmentioning

confidence: 99%

“…Skeletonema marinoi-dohrnii complex and Skeletonema japonicum have been detected in many coastal waters (Yamada et al 2010(Yamada et al , 2013. For example, Canesi and Rynearson (2016) reported that S. marinoi, S. dohrnii, and S. japonicum were observed in Narragansett Bay from November 2010 to January 2011.…”

mentioning

confidence: 99%

Effect of cell size on growth rates of two Skeletonema species and their competitve interactions

Ando

Katano

2018

Journal of Phycology

View full text Add to dashboard Cite

We investigated shifts in growth rates and cell size reduction-restoration processes in two species of diatoms, Skeletonema japonicum and Skeletonema dohrnii. Growth rates greatly fluctuated from 1.0 to 2.1 per day, even under the same conditions. Rates increased from 1.1 to 2.1 per day with decreasing valve diameter; however, rates quickly decreased to 1.0 per day when cell size reached the threshold for initiating auxosporulation. We also conducted co-culture experiments using different size combinations of the two species. The experiment was started using the same cell densities (75 cells · mL ) of both species, and when batch cultures reached late exponential phase, the cultures were reinoculated twice into new medium. When large (valve diameter of 17 μm) S. japonicum cells and small (6 μm) S. dohrnii cells were co-cultured, the S. dohrnii contributed 99% of the total cell density on day 16 (S. dohrnii: 263,900 cells · mL ; S. japonicum: 2,000 cells · mL ). In contrast, when small (9 μm) S. japonicum cells and large (15 μm) S. dohrnii cells were co-cultured, small S. japonicum cells accounted for 97% of the total cell density after only 13 d (S. dohrnii: 1,900 cells · mL ; S. japonicum: 62,500 cells · mL ). This study demonstrated that diatom growth rates covary with cell size, and this phenomenon potentially determines the outcome of competition between species.

show abstract

Species diversity of the marine diatom genus Skeletonema in Japanese brackish water areas

Cited by 16 publications

References 30 publications

Temporal variation of Skeletonema community composition from a long-term time series in Narragansett Bay identified using high-throughput DNA sequencing

Temporal variation of Skeletonema community composition from a long-term time series in Narragansett Bay identified using high-throughput DNA sequencing

Utility of mitochondrial‐encoded cytochrome c oxidase I gene for phylogenetic analysis and species identification of the planktonic diatom genus Skeletonema

Effect of cell size on growth rates of two Skeletonema species and their competitve interactions

Contact Info

Product

Resources

About