Soybean Genomics: Efforts to Reveal the Complex Genome

Harada, Kyuya; Xia, Zhengjun

doi:10.1270/jsbbs.54.215

Cited by 11 publications

(8 citation statements)

References 123 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…One of the most important legume crops in the world, soybean is well known for its high content of good quality seed protein for food and feed purposes, and also for its capability for providing oil needed for industry (Harada and Xia 2004). Soybean seeds also contain sufficient amount of phosphorus required for human health and optimal livestock production, in the form of inositol hexaphosphate otherwise known as phytate (Raboy 2007).…”

Section: Introductionmentioning

confidence: 99%

Molecular characterization of inositol pentakisphosphate 2-kinase (GmlPk1) from soybean and its expression pattern in the developing seeds

Basak¹,

Krishnan²,

Pandey³

et al. 2017

Ind. Jrnl. Gen. Plnt. Bree.

View full text Add to dashboard Cite

The principal storage compound of seeds, phytic acid, poses several problems for agriculture due to its antinutritional effects making the development of low phytate crops a prime priority in research. Soybean, with its high nutritive value, wide acceptability and varied usage, but possessing high levels of phytate can be a major target of low phytate research. To this effect, Inositol pentakisphosphate 2-kinase (IPK1) can prove to be critical player given its key role in catalyzing the terminal step of phytate biosynthesis. In this paper, we report the expression profile of GmIPK1 across different tissues and seed development stages, cloning of 1371 bp nucleotide sequence representing the full length cDNA of GmIPK1 and in silico analysis for characterization. Amino acid sequence of GmIPK1 showed much similarity with that of Phaseolus vulgaris and Cicer arietinum. It also showed the presence of the characteristic Ins_P5_2-kinase domain required for catalytic activity. Thus this study provides an initial idea on the molecular characterization of GmIPK1 enzyme for its further in detailed study and subsequent utilization in generating low phyate soybean with enhanced mineral bioavailability.

show abstract

Section: Introductionmentioning

confidence: 99%

Molecular characterization of inositol pentakisphosphate 2-kinase (GmlPk1) from soybean and its expression pattern in the developing seeds

Basak¹,

Krishnan²,

Pandey³

et al. 2017

Ind. Jrnl. Gen. Plnt. Bree.

View full text Add to dashboard Cite

show abstract

“…If late maturity confers resistance, it might be difficult to develop elite pest-resistant cultivars. We would also face the same difficulty if the genes for resistance and maturity are tightly linked, even though maturity is not the cause of the resistance.Genetic studies on soybean maturity have revealed the positions of some maturity genes and QTLs (Harada and Xia, 2004), but the materials studied were relatively early-maturing cultivars so the effects of the genes and QTLs on the genetic control of late maturity is still unclear. We conducted genetic analysis of the factors involved in the maturity of the Himeshirazu cultivar with the objectives of detecting the positions and effects of QTLs for pubes-…”

mentioning

confidence: 99%

“…Genetic studies on soybean maturity have revealed the positions of some maturity genes and QTLs (Harada and Xia, 2004), but the materials studied were relatively early-maturing cultivars so the effects of the genes and QTLs on the genetic control of late maturity is still unclear. We conducted genetic analysis of the factors involved in the maturity of the Himeshirazu cultivar with the objectives of detecting the positions and effects of QTLs for pubes-cence density and maturity of pest-resistant soybean and also to clarify the effects of pubescence density and maturity on pest resistance.…”

mentioning

confidence: 99%

Quantitative trait loci mapping of pubescence density and flowering time of insect-resistant soybean (Glycine max L. Merr.)

et al. 2007

View full text Add to dashboard Cite

Analysis of antibiosis resistance to common cutworm (Spodoptera litura Fabricius) in soybean (Glycine max (L.) Merr.) has progressed significantly, but the immediate cause remains unknown. We performed quantitative trait loci (QTL) analysis of pubescence density and plant development stage because these factors are assumed to be the immediate cause of resistance to cutworm. The QTLs for pubescence appeared to be identical to the previously detected the Pd1 and Ps loci controlling pubescence density. We found no candidate loci for flowering time QTLs, although one could be identical to the gene governing the long-juvenile trait or to the E6 loci controlling maturity. None of the QTLs overlapped with the QTLs for antibiosis resistance. To reduce damage to soybean (Glycine max (L.) Merr.) plants caused by herbivorous insects, especially the common cutworm (Spodoptera litura Fabricius, Lepidoptera, Noctuidae) (CCW), breeding programs to develop pest-resistant soybean cultivars have been conducted in Japan. We reported that the soybean cultivar Himeshirazu exhibits effective antibiosis resistance to S. litura (Komatsu et al., 2004). We genetically analyzed this resistance using DNA markers and recognized two quantitative trait loci (QTL) for antibiosis resistance to S. litura located on G. max linkage group M which we named CCW-1 and CCW-2 and which explain 28% and 16%, respectively, of phenotypic variance of antibiosis (Komatsu et al., 2005).The genetics of the resistance has been studied (Komatsu et al., 2005) but its immediate cause remains unknown, although pubescence density is a possible factor. Lambert et al. (1992) reported that pupal weight and duration from hatching till pupation of the corn (maize) earworm (Helicoverpa zea Boddie) were affected by pubescence density when near-isogenic soybean lines differing only in pubescence density were used as diet. It is necessary to clarify the relationship between the resistance of the Himeshirazu soybean cultivar to S. litura and pubescence density for better identification of the mechanisms of resistance to S. litura.The plant development stage is also a possible factor in resistance. Nault et al. (1992) reported that mortality of Pseudoplusia includens (Walker) was lower in larvae reared on soybean at the plant reproductive phase than in larvae reared at the vegetative phase. Within the vegetative phase, plant age affected the growth rate of P. includens larvae (Reynolds and Smith, 1985). The Himeshirazu cultivar matures late (maturity group VIII), later than susceptible, mid-maturity cultivars. This later development could contribute to antibiosis resistance, but this would be difficult to determine because it is difficult to synchronize the development stage of all the materials needed for the bioassay. On the other hand, the late maturity of the Himeshirazu cultivar could be an obstacle for the development of elite pestresistant cultivars, because it is too late for the cultivation program followed in Japan. If late maturity confers resistance, it migh...

show abstract

“…Genomic fragments encoding GmPDIL‐1 and GmPDIL‐2 were isolated from the transformation‐competent artificial chromosome (TAC; pYLTAC7) library of the soybean variety ‘Misuzudaizu’ by three‐dimensional screening [45,46]. Screening was performed by PCR using the oligonucleotide primers 5′‐CCCAATTTGGAAGCTGATCACAT‐3′ and 5′‐CTTCCTTGGTCCTACCCCCTTCGT‐3′ for GmPDIL‐1 , and 5′‐AGCCCGAGGTGGACGAGAAGG‐3′ and 5′‐TTTGCCACATCAGGATCCACAGTTT‐3′ for GmPDIL‐2 , and sequencing.…”

Section: Methodsmentioning

confidence: 99%

Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins

et al. 2008

View full text Add to dashboard Cite

Protein disulfide isomerase family proteins play important roles in the folding of nascent polypeptides and the formation of disulfide bonds in the endoplasmic reticulum. In this study, we cloned two similar protein disulfide isomerase family genes from soybean leaf (Glycine max L. Merrill. cv Jack). The cDNAs encode proteins of 525 and 551 amino acids, named GmPDIL‐1 and GmPDIL‐2, respectively. Recombinant versions of GmPDIL‐1 and GmPDIL‐2 expressed in Escherichia coli exhibited oxidative refolding activity for denatured RNaseA. Genomic sequences of both GmPDIL‐1 and GmPDIL‐2 were cloned and sequenced. The comparison of soybean genomic sequences with those of Arabidopsis, rice and wheat showed impressive conservation of exon–intron structure across plant species. The promoter sequences of GmPDIL‐1 apparently contain a cis‐acting regulatory element functionally linked to unfolded protein response. GmPDIL‐1, but not GmPDIL‐2, expression was induced under endoplasmic reticulum‐stress conditions. GmPDIL‐1 and GmPDIL‐2 promoters contain some predicted regulatory motifs for seed‐specific expression. Both proteins were ubiquitously expressed in soybean tissues, including cotyledon, and localized to the endoplasmic reticulum. Data from coimmunoprecipitation experiments suggested that GmPDIL‐1 and GmPDIL‐2 associate with proglycinin, a precursor of the seed storage protein glycinin, and the α′‐subunit of β‐conglycinin, a seed storage protein found in cotyledon cells under conditions that disrupt the folding of glycinin or β‐conglycinin, suggesting that GmPDIL‐1 and GmPDIL‐2 are involved in the proper folding or quality control of such storage proteins as molecular chaperones.

show abstract

Soybean Genomics: Efforts to Reveal the Complex Genome

Cited by 11 publications

References 123 publications

Molecular characterization of inositol pentakisphosphate 2-kinase (GmlPk1) from soybean and its expression pattern in the developing seeds

Molecular characterization of inositol pentakisphosphate 2-kinase (GmlPk1) from soybean and its expression pattern in the developing seeds

Quantitative trait loci mapping of pubescence density and flowering time of insect-resistant soybean (Glycine max L. Merr.)

Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins

Contact Info

Product

Resources

About