Some dynamics of spread and infection by aeciospores of Puccinia punctiformis, a biological control pathogen of Cirsium arvense

Berner, D. K.; Smallwood, Emily; Vanrenterghem, M.; Cavin, Christophe; Michael, J.L.; Shelley, Brett A.; Kolomiets, T. M.; Pankratova, Lyubov; Bruckart, W. L.; Mukhina, Zhanna

doi:10.1016/j.biocontrol.2015.05.001

Cited by 5 publications

(8 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Uredinia will gradually change into telia, containing teliospores, as the season progresses. 8,63,64 There are two opportunities for establishment of systemic infection: in spring by primary urediniospores and in autumn by teliospores. This disease cycle is illustrated in Fig.…”

Section: Californian Thistle Rust (Puccinia Punctiformis (F Strauss) ...mentioning

confidence: 99%

“…Each shoot bears the spermagonia of one mating type, with both mating types being equally represented in a field. 8,63 These produce spermatia, which fuse with receptive hyphae. This results in aeciospores being produced within aecia.…”

Section: Californian Thistle Rust (Puccinia Punctiformis (F Strauss) ...mentioning

confidence: 99%

“…Wind dispersal of uredinospores occurs throughout the growing season, facilitating inoculum spread and subsequent host infection. 63 These infections are normally localized and will not progress into systemic disease, unless they infect a young shoot early in the growing season. Uredinia will gradually change into telia, containing teliospores, as the season progresses.…”

Section: Californian Thistle Rust (Puccinia Punctiformis (F Strauss) ...mentioning

confidence: 99%

See 2 more Smart Citations

Californian thistle (Cirsium arvense): endophytes and Puccinia punctiformis

Kentjens

Casonato

Kaiser

2023

Pest Management Science

View full text Add to dashboard Cite

Californian thistle (Cirisum arvense) is a troublesome weed in pastures and cropping systems. The fungal biocontrol agent Puccinia punctiformis, commonly referred to as thistle rust, performs inconsistently on C. arvense. Problems with P. punctiformis establishment and control of C. arvense may be attributable to differing plant endophytic populations in various environments. This article provides an overview of the relationships between endophytes and their host, but also between endophytes and pathogens with a focus on rust pathogens. This review provides insights into reasons why P. punctiformis performs inconsistently and identifies gaps in our knowledge. Filling these gaps may help to improve performance of this classical fungal biocontrol agent. © 2023 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.

show abstract

Section: Californian Thistle Rust (Puccinia Punctiformis (F Strauss) ...mentioning

confidence: 99%

Section: Californian Thistle Rust (Puccinia Punctiformis (F Strauss) ...mentioning

confidence: 99%

Section: Californian Thistle Rust (Puccinia Punctiformis (F Strauss) ...mentioning

confidence: 99%

See 1 more Smart Citation

Californian thistle (Cirsium arvense): endophytes and Puccinia punctiformis

Kentjens

Casonato

Kaiser

2023

Pest Management Science

View full text Add to dashboard Cite

show abstract

“…Each tube contained 10-20 ng DNA, 5 µL SYBR Green (QIAGEN), 0.13 µM of forward primer PuncF (5' ACCCCTAACACTTGTTTGTG 3') and reverse primers, PuncR (5' GCACTAAAGGTATTGGCAAG 3') (Berner et al 2015a) and PCR H 2 O. Four standards of the rust fungus were used with a known concentration of 1.1 ng, 11 ng, 36.25 ng and 72.5 ng for each reaction.…”

Section: Figurementioning

confidence: 99%

Distribution of <i>Puccinia punctiformis </i>in above-ground tissue of <i>Cirsium arvense </i>(Californian thistle)

Henderson¹,

Cripps²,

Casonato³

2019

NZPP

View full text Add to dashboard Cite

Cirsium arvense (Californian thistle) is a problematic weed in agricultural systems throughout New Zealand and the rust fungus Puccinia punctiformis is a potential biological control agent for this weed. Puccinia punctiformis can systemically infect thistles but the movement of the pathogen in planta is not fully understood. This research determined the level of infection in planta caused by P. punctiformis at a single time point. The concentration of P. punctiformis DNA in planta was determined to ascertain the location of the fungus within naturally field-infected C. arvense. Quantitative polymerase chain reaction was undertaken on above-ground symptomatic and asymptomatic C. arvense tissue at various locations within leaves (top, middle and bottom) and the main stem. All C. arvense shoots had detectable amounts of P. punctiformis but the concentration was 100× greater in symptomatic compared with asymptomatic shoots. In general, the concentration of fungus progressed up the leaves with a significant effect between locations (P<0.001). Puccinia punctiformis was found in planta but broadscale disease of C. arvense does not occur and the reason for this is unknown.

show abstract

“…1 A, B). The aeciospores spread to leaves of nearby CT shoots and produce uredinia and telia in late summer (Fig 1C, Berner et al, 2015b). Under favorable environmental conditions, the two-celled teliospores (Fig 1D), produced in the telia, germinate, undergo meiosis, and produce a basidium with haploid basidiospores (Berner et al, 2013b)).…”

Section: Introductionmentioning

confidence: 99%

Scaling use of the rust fungusPuccinia punctiformisfor biological control of Canada thistle (Cirsium arvense(L.) Scop.): First report on a U.S. statewide effort

Bean,

Gladem,

Rosen

et al. 2023

Preprint

View full text Add to dashboard Cite

Canada thistle (Cirsium arvense(L.) Scop., CT) is one of the worst weeds threatening temperate regions of the world. A host-specific rust fungus,Puccinia punctiformis(F. Strauss) Rohl., is known to cause systemic disease of CT, ultimately killing individuals and reducing stand densities. In 2013, it was demonstrated that fall inoculation of rosettes with coarsely ground leaves bearingP. punctiformistelia can successfully initiate epiphytotics. In the same year, a cooperative project between the Colorado Department of Agriculture and United States Department of Agriculture was initiated, in which CT patches across the state of Colorado (USA) were inoculated and tracked over subsequent years for changes in stem density. Here, we report our findings from 8 years (2014-2021) of monitoring effort. At most sites (N= 87), CT stem densities declined, from a mean (± SE) of 87.9 (± 6.5) stems to 44.7 (± 4.2). These declines however were spatially-autocorrelated, and likely attributable to local growing conditions, as mean annual daily maximum temperature and standard deviation of elevation, as well as climatic conditions around the times of both treatment and monitoring, were found to be important predictors of CT decline. Further, we observed that the amount of inoculum deployed, timing since last release, and method in which it was spread locally at a site were also associated with the magnitude of CT stem decline. These results are indicative of the value ofP. punctiformisas a CT biological control agent. The nameCirsium arvensedieback (CADB) is proposed herein to describe the agriculturally important decline in CT stem densities attributable to this previously un-named systemic disease.

show abstract

Some dynamics of spread and infection by aeciospores of Puccinia punctiformis, a biological control pathogen of Cirsium arvense

Cited by 5 publications

References 18 publications

Californian thistle (Cirsium arvense): endophytes and Puccinia punctiformis

Californian thistle (Cirsium arvense): endophytes and Puccinia punctiformis

Distribution of <i>Puccinia punctiformis </i>in above-ground tissue of <i>Cirsium arvense </i>(Californian thistle)

Scaling use of the rust fungusPuccinia punctiformisfor biological control of Canada thistle (Cirsium arvense(L.) Scop.): First report on a U.S. statewide effort

Contact Info

Product

Resources

About