Sodium-Calcium Exchangers in Rat Trigeminal Ganglion Neurons

Kuroda, Hidetaka; Ubaidus, Sobhan; Sato, Masaki; Tsumura, Maki; Ichinohe, Tatsuya; Tazaki, Masakazu; Shibukawa, Yoshiyuki

doi:10.1186/1744-8069-9-22

Cited by 20 publications

(17 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The activity of Na v 1.7 as a major sodium selective ion channel in sensory neurons could be linked to altered gene expression through effects on second messengers. Changes in sodium levels could have an indirect effect through altered intracellular calcium levels driven by pumps or the sodium/calcium exchangers found in sensory neurons 21 . However, evidence of a direct role for sodium as a transcriptional regulator has come from studies of atrial myocytes and kidney medullary cells where intracellular sodium acting through a salt-dependent kinase can influence gene expression through regulation of the transcription factor nuclear factor of activated T-cells 5 (NFAT5; refs 22 , 23 ).…”

Section: Resultsmentioning

confidence: 99%

“…Calcium is the cation more usually linked to second messenger activity through interaction with a range of enzymes. Altered levels of intracellular sodium ions may result in changes in intracellular calcium through effects on pumps and exchangers 21 . Moreover, at high concentrations, monensin is able to increase intracellular calcium levels in some cells 25 .…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Endogenous opioids contribute to insensitivity to pain in humans and mice lacking sodium channel Nav1.7

et al. 2015

View full text Add to dashboard Cite

Loss-of-function mutations in the SCN9A gene encoding voltage-gated sodium channel Nav1.7 cause congenital insensitivity to pain in humans and mice. Surprisingly, many potent selective antagonists of Nav1.7 are weak analgesics. We investigated whether Nav1.7, as well as contributing to electrical signalling, may have additional functions. Here we report that Nav1.7 deletion has profound effects on gene expression, leading to an upregulation of enkephalin precursor Penk mRNA and met-enkephalin protein in sensory neurons. In contrast, Nav1.8-null mutant sensory neurons show no upregulated Penk mRNA expression. Application of the opioid antagonist naloxone potentiates noxious peripheral input into the spinal cord and dramatically reduces analgesia in both female and male Nav1.7-null mutant mice, as well as in a human Nav1.7-null mutant. These data suggest that Nav1.7 channel blockers alone may not replicate the analgesic phenotype of null mutant humans and mice, but may be potentiated with exogenous opioids.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Resultsmentioning

confidence: 99%

Endogenous opioids contribute to insensitivity to pain in humans and mice lacking sodium channel Nav1.7

et al. 2015

View full text Add to dashboard Cite

show abstract

“…Consistent with the results of the present study, previous expression analysis indicates mRNA for all three NCX isoforms is detectable in sensory neurons (Kuroda et al . ; Shutov et al . ).…”

Section: Discussionmentioning

confidence: 99%

“…Biophysical characterization of NCX activity in sensory neurons is also important in light of recent evidence that NCX can function in ‘reverse mode’ (Kuroda et al . ), a mode that has been suggested to contribute to axon injury observed in some forms of peripheral neuropathy (Ma, ). Third, there is not only evidence of the differential distribution of NCX activity among subpopulations of sensory neurons (we were only able to detect NCX activity in putative nociceptive DRG neurons; Lu et al .…”

Section: Introductionmentioning

confidence: 99%

The properties, distribution and function of Na⁺–Ca²⁺ exchanger isoforms in rat cutaneous sensory neurons

Scheff

Yılmaz

Gold

2014

The Journal of Physiology

View full text Add to dashboard Cite

Key pointsr There has been little if any systematic analysis of the Na + -Ca 2+ exchanger (NCX) in sensory neurons despite conflicting results in the literature regarding the extent to which it contributes to the regulation of intracellular Ca 2+ in these neurons.r While the differential distribution and/or biophysical properties of NCX isoforms may contribute to these conflicting results, only indirect evidence points to the consequences of NCX activity on afferent function.r NCX activity is restricted to a subpopulation of putative nociceptive neurons. r All three NCX isoforms are expressed in putative nociceptive afferents and appear to be differentially distributed along major neuron compartments: central axon, cell body and peripheral axon.r NCX 3 plays a dominant role in the regulation of the duration of the evoked Ca 2+ transient in the cell body, regulation of the action potential conduction velocity, and establishment of nociceptive threshold. Abstract The Na+ -Ca 2+ exchanger (NCX) appears to play an important role in the regulation of the high K + -evoked Ca 2+ transient in putative nociceptive dorsal root ganglion (DRG) neurons. The purpose of the present study was to (1) characterize the properties of NCX activity in subpopulations of DRG neurons, (2) identify the isoform(s) underlying NCX activity, and (3) begin to assess the function of the isoform(s) in vivo. In retrogradely labelled neurons from the glabrous skin of adult male Sprague-Dawley rats, NCX activity, as assessed with fura-2-based microfluorimetry, was only detected in putative nociceptive IB4+ neurons. There were two modes of NCX activity: one was evoked in response to relatively large and long lasting (ß325 nM for >12 s) increases in the concentration of intracellular Ca 2+ ([Ca 2+ ] i ), and a second was active at resting [Ca 2+ ] i > ß150 nM. There also were two modes of evoked activity: one that decayed relatively rapidly (<5 min) and a second that persisted (>10 min). Whereas mRNA encoding all three NCX isoforms (NCX1-3) was detected in putative nociceptive cutaneous neurons with single cell PCR, pharmacological analysis and small interfering RNA (siRNA) knockdown of each isoform in vivo suggested that NCX2 and 3 were responsible for NCX activity. Western blot analyses suggested that NCX isoforms were differentially distributed within sensory neurons. Functional assays of excitability, action potential propagation, and nociceptive behaviour suggest NCX activity has little influence on excitability per se, but instead influences axonal conduction velocity, resting membrane potential, and nociceptive threshold. Together these results indicate that the function of NCX in the regulation of [Ca 2+ ] i in putative nociceptive neurons may be unique relative to other cells in which these exchanger isoforms have been characterized and it has the potential to influence sensory neuron properties at multiple levels.

show abstract

“…Real-time qPCR was performed using an ABI 7300 Real Time PCR system (Life Technologies, USA) with 2× Maxima SYBR green qPCR Master Mix and ROX solution (Thermo, USA). The following primer pairs were used: NCX-1 [24] forward 5'-GTGTTTGTCGCTCTTGGAACCTC-3' and reverse 5'-CGTTGCTTCCGGTGACATTG -3' and RyR-2 forward 5'-AGAGAAGGAAGTGGCACGGAA-3' and reverse 5'-CCAGTAACTCGCTGATTCTGTCT-3' and SERCA-2 forward 5'-ATGAACCTGAAATGGGCAAG-3' and reverse 5'-GGAACTTTGTCACCAACAGCA-3' and Calsequestrin-2 [25] forward 5'- GGAGCATCAAAGACCCACCC -3' and reverse 5'- TTCTCCGCAAATGCCACAAT -3' and GAPDH forward 5'-TGCACCACCAACTGCTTAGC-3' and reverse 5'-GGCATGGACTGTGGTCATGAG-3'. Total RNA (3 μg) was used to perform the reverse transcription reaction.…”

Section: Methodsmentioning

confidence: 99%

Non-Lethal Levels of Oxidative Stress in Response to Short-Term Intermittent Hypoxia Enhance Ca²⁺Handling in Neonatal Rat Cardiomyocytes

Chen

Hsu

Lien

et al. 2014

Cell Physiol Biochem

View full text Add to dashboard Cite

Background/Aims: Intermittent hypoxia (IH) may exert pre-conditioning-like cardioprotective effects and alter Ca²⁺ regulation; however, the exact mechanism of these effects remains unclear. Thus, we examined Ca²⁺-handling mechanisms induced by IH in rat neonatal cardiomyocytes. Methods: Cardiomyocytes were exposed to repetitive hypoxia-re-oxygenation cycles for 1-4 days. Mitochondrial reactive oxygen species (ROS) generation was determined by flow cytometry, and intracellular Ca²⁺ concentrations were measured using a live-cell fluorescence imaging system. Protein kinase C (PKC) isoforms and Ca²⁺-handling proteins were analysed using immunofluorescence and western blotting. Results: After IH exposure for 4 days, the rate of Ca²⁺ extrusion from the cytosol to the extracellular milieu during 40-mM KCl-induced Ca²⁺ mobilization increased significantly, whereas ROS levels increased mildly. IH activated PKC isoforms, which translocated to the membrane from the cytosol, and Na⁺/Ca²⁺ exchanger-1, leading to enhanced Ca²⁺ efflux capacity. Simultaneously, IH increased sarcoplasmic reticulum (SR) Ca²⁺-ATPase and ryanodine receptor 2 (RyR-2) activities and RyR-2 expression, resulting in improved Ca²⁺ uptake and release capacity of SR in cardiomyocytes. Conclusions: IH-induced mild elevations in ROS generation can enhance Ca²⁺ efflux from the cytosol to the extracellular milieu and Ca²⁺-mediated SR regulation in cardiomyocytes, resulting in enhanced Ca²⁺-handling ability.

show abstract

Sodium-Calcium Exchangers in Rat Trigeminal Ganglion Neurons

Cited by 20 publications

References 54 publications

Endogenous opioids contribute to insensitivity to pain in humans and mice lacking sodium channel Nav1.7

Endogenous opioids contribute to insensitivity to pain in humans and mice lacking sodium channel Nav1.7

The properties, distribution and function of Na⁺–Ca²⁺ exchanger isoforms in rat cutaneous sensory neurons

Non-Lethal Levels of Oxidative Stress in Response to Short-Term Intermittent Hypoxia Enhance Ca²⁺Handling in Neonatal Rat Cardiomyocytes

Contact Info

Product

Resources

About

Sodium-Calcium Exchangers in Rat Trigeminal Ganglion Neurons

Cited by 20 publications

References 54 publications

Endogenous opioids contribute to insensitivity to pain in humans and mice lacking sodium channel Nav1.7

Endogenous opioids contribute to insensitivity to pain in humans and mice lacking sodium channel Nav1.7

The properties, distribution and function of Na+–Ca2+ exchanger isoforms in rat cutaneous sensory neurons

Non-Lethal Levels of Oxidative Stress in Response to Short-Term Intermittent Hypoxia Enhance Ca2+Handling in Neonatal Rat Cardiomyocytes

Contact Info

Product

Resources

About

The properties, distribution and function of Na⁺–Ca²⁺ exchanger isoforms in rat cutaneous sensory neurons

Non-Lethal Levels of Oxidative Stress in Response to Short-Term Intermittent Hypoxia Enhance Ca²⁺Handling in Neonatal Rat Cardiomyocytes