Sodium Butyrate Supplementation Inhibits Hepatic Steatosis by Stimulating Liver Kinase B1 and Insulin-Induced Gene

Zhao, Zhibin; Wang, Zixuan; Zhou, Detang; Han, Yamei; Ma, Fengguang; Hu, Zhimin; Xin, Feng‐Zhi; Liu, Xiaolin; Ren, Tianyi; Zhang, Feifei; Xue, Yaqian; Cui, Aoyuan; Liu, Zhengshuai; Bai, Jinyun; Liu, Yu-Xiao; Cai, Genxiang; Su, Weitong; Dai, Xiaozhen; Shen, Feng; Pan, Qin; Liu, Yu; Fan, Jian‐Gao

doi:10.1016/j.jcmgh.2021.05.006

Cited by 50 publications

(52 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The HFD-mice showed elevated ALT and AST indicating hepatic stress which returned to normal in HFD-butyrate-mice. Our results are concordant with earlier reports on the beneficial effect of butyrate on liver damage and dyslipidemia 38 , 44 .…”

Section: Discussionsupporting

confidence: 94%

“…To witness the effect of butyrate on the cholesterol metabolic landscape, we undertook studies with Huh7 cell line, which is known to have higher miR122 expression 49 . The butyrate concentration used was in tune with an earlier study 38 . For in vitro experiments on a cancer cell like Huh7 relatively higher dose of butyrate was needed for gene expression study.…”

Section: Discussionmentioning

confidence: 99%

“…To assess the effects of SCFAs on cellular cholesterol biogenesis, Huh7 was treated with increasing concentration (0-20mM) of either sodium butyrate (butyrate) or sodium propionate (propionate) or sodium acetate (aceatate) for 24h following which cellular cholesterol was measured. The concentration of SCFAs used in the study based on the earlier reports 38 . It was observed that unlike propionate and acetate (Fig S1), 5mM, 10mM and 20mM butyrate treatment caused 25%, 40% and 75% decrease in cellular cholesterol, respectively (Fig S1A inset).…”

Section: Butyrate Is More Effective Than Propionate and Acetate In Re...mentioning

confidence: 99%

See 2 more Smart Citations

AUF-1 knock down in mice overarches butyrate driven hypo-cholesteraemia by conjuring AUF-1-Dicer-1-miR122 hierarchy

Das

Kundu

Ghosh

et al. 2022

Preprint

View full text Add to dashboard Cite

This discourse probes the mechanistic molecular details of butyrate action in maintaining host- cholesterol balance. Hepatic miR122 being the most indispensable regulator of cholesterol metabolic enzymes, we studied upstream players of miR122 biogenesis in the presence and absence of butyrate in Huh7 cells and mice model. We showed that butyrate treatment caused upregulation of RNA-binding protein, AUF-1 resulting in RNase-III nuclease, Dicer-1 instability, and significant diminution of miR122. We proved its importance of AUF-1 and sequential downstream players in AUF-1-knock-down mice. We synthesized unique self-transfecting GMO (guanidinium-morpholino- oligonucleotides) linked PMO (Phosphorodiamidate-Morpholino Oligonucleotides)-based antisense reagent and injection of which in mouse caused near absence of AUF-1 coupled with increased Dicer- 1 and miR122, and reduced serum cholesterol regardless of butyrate treatment indicating that butyrate acts though AUF-1. The roster of intracellular players was as follows: AUF-1-Dicer-1-miR122 for triggering butyrate driven hypocholesterlaemia. To our knowledge this is the first report linking AUF-1 with cholesterol biogenesis.

show abstract

Section: Discussionsupporting

confidence: 94%

Section: Discussionmentioning

confidence: 99%

Section: Butyrate Is More Effective Than Propionate and Acetate In Re...mentioning

confidence: 99%

See 1 more Smart Citation

AUF-1 knock down in mice overarches butyrate driven hypo-cholesteraemia by conjuring AUF-1-Dicer-1-miR122 hierarchy

Das

Kundu

Ghosh

et al. 2022

Preprint

View full text Add to dashboard Cite

show abstract

“…Remarkably, dietary SCFAs ameliorate hepatic steatosis and insulin resistance in diet-induced obese mice, through a reduction in intrahepatic lipid accumulation [72][73][74]. SCFA-fed mice displayed reduced hepatic and protein expression of lipogenic enzymes [74][75][76][77]. Gut-derived SCFAs have also been reported to have a direct impact on FA synthesis, with only mild regulatory effects on the expression of genes involved in hepatic lipid metabolism [78].…”

Section: Gut Microbiota-derived Short-chain Fatty Acids and Nafldmentioning

confidence: 99%

The Role of Fatty Acids in Non-Alcoholic Fatty Liver Disease Progression: An Update

Hliwa

Ramos‐Molina

Łaski

et al. 2021

IJMS

View full text Add to dashboard Cite

Non-alcoholic fatty liver disease (NAFLD) is a major public health problem worldwide. NAFLD (both simple steatosis and steatohepatitis) is characterized by alterations in hepatic lipid metabolism, which may lead to the development of severe liver complications including cirrhosis and hepatocellular carcinoma. Thus, an exhaustive examination of lipid disorders in the liver of NAFLD patients is much needed. Mass spectrometry-based lipidomics platforms allow for in-depth analysis of lipid alterations in a number of human diseases, including NAFLD. This review summarizes the current research on lipid alterations associated with NAFLD and related complications, with special emphasis on the changes in long-chain and short-chain fatty acids levels in both serum and liver tissue, as well as in the hepatic expression of genes encoding the enzymes catalyzing lipid interconversions.

show abstract

“…RNA was reverse transcribed using the HiScript II Q RT SuperMix for qPCR Kit (Vazyme, Nanjing, China). The resulting cDNA was subjected to real-time PCR with gene-specific primers in the presence of SYBR Green PCR master mix (Applied Biosystems) using StepOnePlus Real-Time PCR System (Applied Biosystems) as described previously ( 20 ). The following quantitative RT-PCR primer sequences were used: CATTGCTGACAGGATGCAGAAGG (Forward) and TGCTGGAAGGTGGACAGTGAGG (Reverse) for mouse β-actin; GGAGCCATGGATTGCACATT (Forward) and GGCCCGGGAAGTCACTGT (Reverse) for mouse SREBP1c; GCTGCGGAAACTTCAGGAAAT (Forward) and AGAGACGTGTCACTCCTGGACTT (Reverse) for mouse FAS; TTCTTCTCTCACGTGGGTTG (Forward) and CGGGCTTGTAGTACCTCCTC (Reverse) for mouse SCD1; GGGCAGAGCAAGTCATCTTC (Forward) and CCTCTGGAAGCACTGAGGAC (Reverse) for mouse PPARα; CCAGGCTACAGTGGGACATT (Forward) and GAACTTGCCCATGTCCTTGT (Reverse) for mouse CPT1A; ATTTCACTTCCAAGGCTGCC (Forward) and CTGGTCCTGGTCATCTCTCC (Reverse) for mouse TNFα; AGTTGCCTTCTTGGGACTGA (Forward) and TCCACGATTTCCCAGAGAAC (Reverse) for mouse IL-6; TTAAAAACCTGGATCGGAACCAA (Forward) and GCATTAGCTTCAGATTTACGGGT (Reverse) for mouse CCL2; AGCACATGTGGTGAATCCAA (Forward) and TGCCATCATAAAGGAGCCA (Reverse) for mouse CCR2; TGCTTCCTCCTCCTCCTTTG (Forward) and GAAGTACTGCCGTTTTCCCC (Reverse) for mouse αSMA; CCTGCAAGACCATCGACATG (Forward) and GCGAGCCTTAGTTTGGACAG (Reverse) for mouse TGFβ; CCAGCAAACAAAGGCAATGC (Forward) and GGTGCTGGGTAGGGAAGTAG (Reverse) for mouse COL1α1; CAACTCAGCTCGCCTTCATG (Forward) and CTCATCCAGGTACGCAATGC (Reverse) for mouse COL1α2.…”

Section: Methodsmentioning

confidence: 99%

Ammonia Scavenger Restores Liver and Muscle Injury in a Mouse Model of Non-alcoholic Steatohepatitis With Sarcopenic Obesity

Wang

Yang

et al. 2022

Front. Nutr.

Self Cite

View full text Add to dashboard Cite

Recent studies have revealed that sarcopenia is closely associated with obesity and non-alcoholic steatohepatitis (NASH). However, few attempted to explore the cause-and-effect relationship between sarcopenic obesity and NASH. In this study, we investigated muscular alterations in a rodent NASH model to elucidate their intrinsic relations and explore the potential therapeutic target. Forty-six 8-week-old and twenty 42-week-old male C57BL/6 mice (defined as young and middle-aged mice, respectively) were fed with a high-fat diet (HFD) for 12 or 20 weeks. A subset of young mice was subjected to ammonia lowering treatment by L-ornithine L-aspartate (LOLA). We examined body composition and muscle strength by nuclear magnetic resonance and grip strength meter, respectively. At the end of the 12th week, all HFD-fed mice developed typical steatohepatitis. Meanwhile, sarcopenia occurred in HFD-fed middle-aged mice, whereas young mice only demonstrated decreased grip strength. Until the end of week 20, young mice in the HFD group exhibited significant sarcopenia and obesity phenotypes, including decreased lean body mass and grip strength, and increased body fat mass and percentage body fat. Additionally, plasma ammonia level was markedly increased in HFD-fed mice of both ages at week 20. Plasma ammonia level was negatively associated with muscle strength and myofiber diameter in young mice. LOLA can significantly reduce plasma levels of ammonia, alanine aminotransaminase, aspartate aminotransaminase, and cholesterol in mice fed an HFD. Hepatic infiltration of inflammatory cells and collagen deposition area were significantly decreased in HFD group by LOLA treatment. Meanwhile, LOLA significantly increased lean body mass, grip strength, and average muscle fiber diameter of HFD-fed mice. These findings suggest that the occurrence of NASH precedes sarcopenia in HFD mice, and the steatohepatitis-related hyperammonemia might contribute to the pathogenesis of sarcopenia. LOLA might be an effective drug for both steatohepatitis and sarcopenic obesity.

show abstract

Sodium Butyrate Supplementation Inhibits Hepatic Steatosis by Stimulating Liver Kinase B1 and Insulin-Induced Gene

Cited by 50 publications

References 46 publications

AUF-1 knock down in mice overarches butyrate driven hypo-cholesteraemia by conjuring AUF-1-Dicer-1-miR122 hierarchy

AUF-1 knock down in mice overarches butyrate driven hypo-cholesteraemia by conjuring AUF-1-Dicer-1-miR122 hierarchy

The Role of Fatty Acids in Non-Alcoholic Fatty Liver Disease Progression: An Update

Ammonia Scavenger Restores Liver and Muscle Injury in a Mouse Model of Non-alcoholic Steatohepatitis With Sarcopenic Obesity

Contact Info

Product

Resources

About