SNAIL1-mediated downregulation of FOXA proteins facilitates the inactivation of transcriptional enhancer elements at key epithelial genes in colorectal cancer cells

Abstract

Phenotypic conversion of tumor cells through epithelial-mesenchymal transition (EMT) requires massive gene expression changes. How these are brought about is not clear. Here we examined the impact of the EMT master regulator SNAIL1 on the FOXA family of transcription factors which are distinguished by their particular competence to induce chromatin reorganization for the activation of transcriptional enhancer elements. We show that the expression of SNAIL1 and FOXA genes is anticorrelated in transcriptomes of colorectal tumors and cell lines. In cellular EMT models, ectopically expressed Snail1 directly represses FOXA1 and triggers downregulation of all FOXA family members, suggesting that loss of FOXA expression promotes EMT. Indeed, cells with CRISPR/Cas9-induced FOXA-deficiency acquire mesenchymal characteristics. Furthermore, ChIP-seq data analysis of FOXA chromosomal distribution in relation to chromatin structural features which characterize distinct states of transcriptional activity, revealed preferential localization of FOXA factors to transcriptional enhancers at signature genes that distinguish epithelial from mesenchymal colon tumors. To validate the significance of this association, we investigated the impact of FOXA factors on structure and function of enhancers at the CDH1, CDX2 and EPHB3 genes. FOXA-deficiency and expression of dominant negative FOXA2 led to chromatin condensation at these enhancer elements. Site-directed mutagenesis of FOXA binding sites in reporter gene constructs and by genome-editing in situ impaired enhancer activity and completely abolished the active chromatin state of the EPHB3 enhancer. Conversely, expression of FOXA factors in cells with inactive CDX2 and EPHB3 enhancers led to chromatin opening and de novo deposition of the H3K4me1 and H3K27ac marks. These findings establish the pioneer function of FOXA factors at enhancer regions of epithelial genes and demonstrate their essential role in maintaining enhancer structure and function. Thus, by repressing FOXA family members, SNAIL1 targets transcription factors at strategically important positions in gene-regulatory hierarchies, which may facilitate transcriptional reprogramming during EMT.

SNAIL1 employs β‐Catenin‐LEF1 complexes to control colorectal cancer cell invasion and proliferation

“…Thus, additional transcription factors and signalling pathways must exist whose activation and repression contributes to the aggregated gene expression changes in the course of EMT. FOXA and SMAD proteins, AP4, and PBX3 are transcription factors with roles in EMT suppression and execution . Therefore, the conversion of epithelial into mesenchymal gene expression likely follows a gradual and hierarchical pattern whereby core EMT TFs trigger sequential changes in the activity of an expanding number of signalling pathways and TFs .…”

“…45 Alternatively, SNAIL1 may downregulate a repressor of LEF1, since LEF1 expression increases upon inactivation of the SNAIL1 target gene FOXA1. 24 As LEF1 is a β-Cateninresponsive gene, 46 its upregulation could also result from a boost in β-Catenin transcriptional activity. 11 This could also explain the induction of Lef1 in Apc-deleted organoids.…”

“…FOXA and SMAD proteins, AP4, and PBX3 are transcription factors with roles in EMT suppression and execution. 14,24,[47][48][49] Therefore, the conversion of epithelial into mesenchymal gene expression likely follows a gradual and hierarchical pattern whereby core EMT TFs trigger sequential changes in the activity of an expanding number of signalling pathways and TFs. 50 An intriguing question is whether the same EMT executioner mechanisms operate regardless of cellular background.…”

“…The LEF1 gRNA sequences were as follows: exon 3 (gRNA1) 5′‐ GTACCCGGAATAACTCGAGT‐3′; exon 2 (gRNA2) 5′‐TCAGGAGCCCTACCACGACA‐3′; exon 1: 5′‐GAAGGGGATCATCTCGTCCG‐3′ (gRNA T1) and 5′‐GATTTCAGACTCGTTCACCA‐3′ (gRNA T2). gRNAs were selected using online tools (http://crispr.mit.edu/ ; https://crispr.cos.uni-heidelberg.de/), and cloned into the addgene plasmid #41824 as before . For Cas9‐turboRFP expression, GFP was excised from plasmid #44719 (addgene) and replaced by turboRFP using Gibson assembly.…”

“…de/), and cloned into the addgene plasmid #41824 as before. 24 For Cas9-turboRFP expression, GFP was excised from plasmid #44719 (addgene) and replaced by turboRFP using Gibson assembly. The donor plasmid for the knock-in was constructed by PCR amplification of portions of the LEF1 locus from LS174T cells and transferring the sequences into pUC18.…”