Small Molecule Inhibitors of BAF; A Promising Family of Compounds in HIV-1 Latency Reversal

Abstract

Persistence of latently infected cells in presence of Anti-Retroviral Therapy presents the main obstacle to HIV-1 eradication. Much effort is thus placed on identification of compounds capable of HIV-1 latency reversal in order to render infected cells susceptible to viral cytopathic effects and immune clearance. We identified the BAF chromatin remodeling complex as a key player required for maintenance of HIV-1 latency, highlighting its potential as a molecular target for inhibition in latency reversal. Here, we screened a recently identified panel of small molecule inhibitors of BAF (BAFi's) for potential to activate latent HIV-1. Latency reversal was strongly induced by BAFi's Caffeic Acid Phenethyl Ester and Pyrimethamine, two molecules previously characterized for clinical application. BAFi's reversed HIV-1 latency in cell line based latency models, in two ex vivo infected primary cell models of latency, as well as in HIV-1 infected patient's CD4 + T cells, without inducing T cell proliferation or activation. BAFi-induced HIV-1 latency reversal was synergistically enhanced upon PKC pathway activation and HDAC-inhibition. Therefore BAFi's constitute a promising family of molecules for inclusion in therapeutic combinatorial HIV-1 latency reversal.

Small Molecule Targeting of Specific BAF (mSWI/SNF) Complexes for HIV Latency Reversal

“…Importantly, in line with the mechanism of action of BRD-K80443127 as an LTR de-repressor, co-treatment with the PKC agonist prostratin, which is a bona fide activator of HIV transcription resulted in significant increase in cell associated HIV RNA in all patients. This is in line with recent findings that ARID1A degraders from our previous studies (Stoszko et al, 2016) act to increase transcriptional noise (frequency or burst) at the HIV-1 LTR promoter (Megaridis et al, 2018). This points to the potential for this class of compounds for inclusion in combinatorial therapy with other drugs targeting different steps in HIV-1 transcription.…”

“…We investigated how nucleosome occupancy at the 5’-LTR changes upon treatment with BRD-K80443127 in J-Lat 11.1 using the formaldehyde assisted isolation of regulatory elements (FAIRE) assay, which is a measure of chromatin accessibility (Giresi et al, 2007). Overnight compound treatment resulted in increased chromatin accessibility at the Nuc-1 position of the 5’ LTR (Figure 5G) mimicking the effect elicited by the siRNA knockdown of ARID1A and treatment with BAF inhibitors identified in our previous studies (Rafati et al, 2011; Stoszko et al, 2016). …”

“…Primary CD4 + T cells were isolated from buffy coats from healthy donors by Ficoll gradient followed by density-based negative selection of CD4+ T cells with RosetteSep kit (StemCells Technologies). Twenty-four hours after isolation, cells were spin-infected as described, with minor modifications (Lassen et al, 2012; Stoszko et al, 2016). CD4+ T cells were spin-infected at 1200 g for 2 h with the HBX2 Env pseudotyped pNL4.3-Luc virus.…”

“…CD4+ T cells from aviremic HIV+ patients were isolated as described previously (Stoszko et al, 2016) with minor modifications. Briefly, frozen PBMCs were cultured in RPMI medium over-night to recover.…”

“…After 24 hours cells were lysed in TRIreagent (Sigma), total RNA was isolated with Total RNA Zol-Out (A&A Biotechnology) kit and cDNA was synthetized using random primers and Superscript II Reverse Transcriptase (Life Technologies). Detection of cellular associated pol RNA was performed as described previously (Pol: For GGTTTATTACAGGGACAGCAGAGA, Rev-ACCTGCCATCTGTTTTCCATA) (Stoszko et al, 2016). This study was conducted in accordance with the ethical principles of the Declaration of Helsinki.…”