Slow-inactivation induced conformational change in domain 2-segment 6 of cardiac Na+ channel

O’Reilly, John; Shockett, Penny E.

doi:10.1016/j.bbrc.2006.04.049

Cited by 8 publications

(22 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Site-directed mutagenesis of wild-type human cardiac muscle hNa v1.5 (12) was carried out as described previously (28). Mutagenic oligonucleotides (Operon Biotechnologies, Huntsville, AL) included: N927K-top, GTTATGGTCATTGGCAAGCTTGTGGTCC-TGAATCTC; N927K-bot, GAGATTCAGGACCACAAGCTTGCCAA-TGACCATAAC; L931K-top, GTCATTGGCAACCTTGTGGTCAAGA-ATCTCTTCCTGGCCTTG; L931K-bot, CAAGGCCAGGAAGAGAT-TCTTGACCACAAGGTTGCCAATGAC; V930R-top, GTCATTGGCA-ACCTTGTGCGCCTGAATCTCTTCCTGGCC; V930R-bot, GGCCAG-GAAGAGATTCAGGCGCACAAGGTTGCCAATGAC; V930Q-top, GTCATTGGCAACCTTGTGCAGCTGAATCTCTTCCTGGCC; V930Q-bot, GGCCAGGAAGAGATTCAGCTGCACAAGGT-TGCCAATGAC; V930A-top, GTCATTGGCAACCTTGTGGC-CCTGAATCTCTTCCTGGCC; V930A-bot, GGCCAGGAA-GAGATTCAGGGCCACAAGGTTGCCAATGAC; V930D-top, GT-CATTGGCAACCTTGTGGACCTGAATCTCTTCCTGGCC; and V930D-bot, GGCCAGGAAGAGATTCAGGTCCACAAGGT-TGCCAATGAC.…”

Section: Na ϩ Channel Mutant Construction and Transient Transfection mentioning

confidence: 99%

“…The V930K and V930C mutants were provided by Dr. Sho-Ya Wang (SUNY Albany, Albany, NY). cDNA clones (5-20 g) of wild-type hNa v1.5 and hNav1.5 mutants were expressed from pcDNA1-Amp (Invitrogen, Carlsbad, CA) after transient transfection into human embryonic kidney (HEK) cells by calcium phosphate precipitation (13) as previously described (28,29). The transfection included 1-2 g of a cDNA clone encoding cell surface antigen CD8 (OriGene, Rockville, MD).…”

Section: Na ϩ Channel Mutant Construction and Transient Transfection mentioning

confidence: 99%

“…Support for this hypothesis comes from studies showing that substitution of alanine for native asparagine (N434A) in D1-S6 of rNa v 1.4 enhances slow inactivation (56), substitution of different residues in the same isoform at V787 in D2-S6 produces enhancement of or resistance to slow inactivation (30), slow inactivation in rat brain Na v isoform rNa v 1.2 can be enhanced or diminished with substitutions at N1466 in D3-S6 (7), and tryptophan or lysine substitution in D4-S6 in S1759W or S1759K in the human cardiac Na v isoform hNav1.5 produces a biphasic effect on slow inactivation (55). In addition, molecular movement during Na v slow inactivation was demonstrated by MTS modification at V1583C in D4-S6 in the closed state, but not the slow-inactivated state (44), and at V787C of D2-S6 in rNa v 1.4 and the homologous mutant V930C in hNa v 1.5 in the slow-inactivated state, but not the closed state (28,30). Together, these data suggest that dynamic molecular rearrangement or movement in the S6 segments lining the inner pore of Na v s is required during slow inactivation.…”

mentioning

confidence: 98%

“…Studies with Na v chimeras using domains from hNa v 1.5 and rNa v 1.4 demonstrated that if D1 and D2 (or D1, D2, and D3) are from rNa v 1.4, then entry into, steady state, and recovery from slow inactivation resemble that of rNa v 1.4 (29) suggesting that D1 and D2 play a role in determining slow inactivation phenotype. Interestingly, molecular rearrangement during slow inactivation at V930 in D2-S6 of cardiac hNa v 1.5, albeit requiring more time, can be detected as in V787C in rNa v 1.4 (28,30), suggesting that there are some shared mechanistic components of slow inactivation in Na v isoforms that differ in overall slow inactivation phenotypes (29,35). These results demonstrate that comparative studies between different Na v s provide important information about kinetic processes that can vary among isoforms (11,26,37).…”

mentioning

confidence: 99%

“…The second hypothesis poses that slow inactivation involves conformational changes in the putative pore-lining S6 transmembrane segments of the four domains: D1-S6, D2-S6, D3-S6, and D4-S6 (7,28,30,44,55,56). Support for this hypothesis comes from studies showing that substitution of alanine for native asparagine (N434A) in D1-S6 of rNa v 1.4 enhances slow inactivation (56), substitution of different residues in the same isoform at V787 in D2-S6 produces enhancement of or resistance to slow inactivation (30), slow inactivation in rat brain Na v isoform rNa v 1.2 can be enhanced or diminished with substitutions at N1466 in D3-S6 (7), and tryptophan or lysine substitution in D4-S6 in S1759W or S1759K in the human cardiac Na v isoform hNav1.5 produces a biphasic effect on slow inactivation (55).…”

mentioning

confidence: 99%

See 4 more Smart Citations

Relative resistance to slow inactivation of human cardiac Na⁺ channel hNa_v1.5 is reversed by lysine or glutamine substitution at V930 in D2-S6

Chancey¹,

Shockett²,

O’Reilly³

2007

American Journal of Physiology-Cell Physiology

Self Cite

View full text Add to dashboard Cite

Chancey JH, Shockett PE, O'Reilly JP. Relative resistance to slow inactivation of human cardiac Na ϩ channel hNav1.5 is reversed by lysine or glutamine substitution at V930 in D2-S6. Am J Physiol Cell Physiol 293: C1895-C1905, 2007. First published October 10, 2007; doi:10.1152/ajpcell.00377.2007.-Transmembrane segment 6 is implicated in slow inactivation (SI) of voltage-gated Na ϩ channels (Na vs). To further study its role and understand differences between SI phenotypes of different Nav isoforms, we analyzed several domain 2-segment 6 (D2-S6) mutants of the human cardiac hNa v1.5, which is relatively resistant to SI. Mutants were examined by transient HEK cell transfection and patch-clamp recording of whole cell Na ϩ currents. Substitutions with lysine (K) included N927K, V930K, and L931K. We show recovery from short (100 ms) depolarization to 0 mV in N927K and L931K is comparable to wild type, whereas recovery in V930K is delayed and biexponential, suggesting rapid entry into a slow-inactivated state. SI protocols confirm enhanced SI phenotype (rapid development, hyperpolarized steady state, slowed recovery) for V930K, contrasting with the resistant phenotype of wild-type hNav1.5. This enhancement, not found in N927K or L931K, suggests that the effect in V930K is site specific. Glutamine (Q) substituted at V930 also exhibits an enhanced SI phenotype similar to that of V930K. Therefore, K or Q substitution eliminates hNav1.5 resistance to SI. Alanine (A) or cysteine (C) substitution at V930 shows no enhancement of SI, and in fact, V930A and V930C, as well as L931K, exhibit a resistance to SI, demonstrating that characteristics of specific amino acids (e.g., size, hydrophobicity) differentially affect SI gating. Thus V930 in D2-S6 appears to be an important structural determinant of SI gating in hNa v1.5. We suggest that conformational change involving D2-S6 is a critical component of SI in Na vs, which may be differentially regulated between isoforms by other isoformspecific determinants of SI phenotype. sodium channel; voltage gating; site-directed mutagenesis

show abstract

Section: Na ϩ Channel Mutant Construction and Transient Transfection mentioning

confidence: 99%

Section: Na ϩ Channel Mutant Construction and Transient Transfection mentioning

confidence: 99%

mentioning

confidence: 98%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 3 more Smart Citations

Relative resistance to slow inactivation of human cardiac Na⁺ channel hNa_v1.5 is reversed by lysine or glutamine substitution at V930 in D2-S6

Chancey¹,

Shockett²,

O’Reilly³

2007

American Journal of Physiology-Cell Physiology

Self Cite

View full text Add to dashboard Cite

show abstract

Mechanism of Inactivation in Voltage-Gated Na+ Channels

Gawali

Todt

2016

Na Channels From Phyla to Function

View full text Add to dashboard Cite

Time- and state-dependent effects of methanethiosulfonate ethylammonium (MTSEA) exposure differ between heart and skeletal muscle voltage-gated Na+ channels

O’Reilly

Shockett

2012

Biochimica et Biophysica Acta (BBA) - Biomembranes

Self Cite

View full text Add to dashboard Cite

The substituted-cysteine scanning method (SCAM) is used to study conformational changes in proteins. Experiments using SCAM involve site-directed mutagenesis to replace native amino acids with cysteine and subsequent exposure to a methanethiosulfonate (MTS) reagent such as methanethiosulfonate ethylammonium (MTSEA). These reagents react with substituted-cysteines and can provide functional information about relative positions of amino acids within a protein. In the human heart voltage-gated Na+ channel hNav1.5 there is a native cysteine at position C373 that reacts rapidly with MTS reagents resulting in a large reduction in whole-cell Na+ current (INa). Therefore, in order to use SCAM in studies in this isoform, this native cysteine is mutated to a non-reactive residue, e.g., tyrosine. This mutant, hNav1.5-C373Y, is resistant to the MTS-mediated decrease in INa. Here we show that this resistance is time- and state-dependent. With relatively short exposure times to MTSEA (<4 min), there is little effect on INa. However, with longer exposures (4–8 min), there is a large decrease in INa, but this effect is only found when hNav1.5-C373Y is inactivated (fast or slow) — MTSEA has little effect in the closed state. Additionally, this long-term, state-dependent effect is not seen in human skeletal muscle Na+ channel isoform hNav1.4, which has a native tyrosine at the homologous site C407. We conclude that differences in molecular determinants of inactivation between hNav1.4 and hNav1.5 underlie the difference in response to MTSEA exposure.

show abstract

Slow-inactivation induced conformational change in domain 2-segment 6 of cardiac Na+ channel

Cited by 8 publications

References 38 publications

Relative resistance to slow inactivation of human cardiac Na⁺ channel hNa_v1.5 is reversed by lysine or glutamine substitution at V930 in D2-S6

Relative resistance to slow inactivation of human cardiac Na⁺ channel hNa_v1.5 is reversed by lysine or glutamine substitution at V930 in D2-S6

Mechanism of Inactivation in Voltage-Gated Na+ Channels

Time- and state-dependent effects of methanethiosulfonate ethylammonium (MTSEA) exposure differ between heart and skeletal muscle voltage-gated Na+ channels

Contact Info

Product

Resources

About

Slow-inactivation induced conformational change in domain 2-segment 6 of cardiac Na+ channel

Cited by 8 publications

References 38 publications

Relative resistance to slow inactivation of human cardiac Na+ channel hNav1.5 is reversed by lysine or glutamine substitution at V930 in D2-S6

Relative resistance to slow inactivation of human cardiac Na+ channel hNav1.5 is reversed by lysine or glutamine substitution at V930 in D2-S6

Mechanism of Inactivation in Voltage-Gated Na+ Channels

Time- and state-dependent effects of methanethiosulfonate ethylammonium (MTSEA) exposure differ between heart and skeletal muscle voltage-gated Na+ channels

Contact Info

Product

Resources

About

Relative resistance to slow inactivation of human cardiac Na⁺ channel hNa_v1.5 is reversed by lysine or glutamine substitution at V930 in D2-S6

Relative resistance to slow inactivation of human cardiac Na⁺ channel hNa_v1.5 is reversed by lysine or glutamine substitution at V930 in D2-S6