Site‐specific transgenesis in <i>Xenopus</i>

Zuber, Michael E.; Nihart, Heather S.; Zhuo, Xinming; Babu, Sudha; Knox, Barry E.

doi:10.1002/dvg.22006

Cited by 7 publications

(4 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…While several different methods of transgenesis have been used to label specific cells in X. laevis (e.g., Ogino et al, ; Amaya and Kroll, ; Haeri and Knox, ; Ishibashi et al, ; Zuber et al, ; Takagi et al, ; Tam et al, ; Wang and Szaro, ), Tol2 has only been used to test potential skeletal muscle enhancers (Loots et al, ). Therefore, before our study, it was unclear whether this method of transgenesis would be generally succesful in this animal.…”

Section: Introductionmentioning

confidence: 99%

Zebrafish transgenic constructs label specific neurons in Xenopus laevis spinal cord and identify frog V0v spinal neurons

Juárez-Morales¹,

Luna

Zuber

et al. 2017

Developmental Neurobiology

Self Cite

View full text Add to dashboard Cite

A correctly functioning spinal cord is crucial for locomotion and communication between body and brain but there are fundamental gaps in our knowledge of how spinal neuronal circuitry is established and functions. To understand the genetic program that regulates specification and functions of this circuitry, we need to connect neuronal molecular phenotypes with physiological analyses. Studies using Xenopus laevis tadpoles have increased our understanding of spinal cord neuronal physiology and function, particularly in locomotor circuitry. However, the X. laevis tetraploid genome and long generation time make it difficult to investigate how neurons are specified. The opacity of X. laevis embryos also makes it hard to connect functional classes of neurons and the genes that they express. We demonstrate here that Tol2 transgenic constructs using zebrafish enhancers that drive expression in specific zebrafish spinal neurons label equivalent neurons in X. laevis and that the incorporation of a Gal4:UAS amplification cassette enables cells to be observed in live X. laevis tadpoles. This technique should enable the molecular phenotypes, morphologies and physiologies of distinct X. laevis spinal neurons to be examined together in vivo. We have used an islet1 enhancer to label Rohon-Beard sensory neurons and evx enhancers to identify V0v neurons, for the first time, in X. laevis spinal cord. Our work demonstrates the homology of spinal cord circuitry in zebrafish and X. laevis, suggesting that future work could combine their relative strengths to elucidate a more complete picture of how vertebrate spinal cord neurons are specified, and function to generate behavior.

show abstract

Section: Introductionmentioning

confidence: 99%

Zebrafish transgenic constructs label specific neurons in Xenopus laevis spinal cord and identify frog V0v spinal neurons

Juárez-Morales¹,

Luna

Zuber

et al. 2017

Developmental Neurobiology

Self Cite

View full text Add to dashboard Cite

show abstract

“…To accelerate FLP protein aggregation in the pre-blastoderm of silkworm eggs, FLP mRNA can be injected into the embryos of TTSs to direct FLP recombinase synthesis. At present, this method has only been reported in some higher model organisms such as zebrafish ( Danio rerio ) [46] and Xenopus laevis [47] , showning a high recombination efficiency in somatic cells of transgenic zebrafish ( Table 4 ). Although a low efficiency of FLP/ FRT system-mediated site-specific gene excision was obtained in the current study, the recombination efficiency was similar to the piggyBac -mediated transgenic germline transformation of the silkworm [38] , [48] , which is the most conventional transgenic methodology for this species.…”

Section: Discussionmentioning

confidence: 99%

FLP Recombinase-Mediated Site-Specific Recombination in Silkworm, Bombyx mori

et al. 2012

View full text Add to dashboard Cite

A comprehensive understanding of gene function and the production of site-specific genetically modified mutants are two major goals of genetic engineering in the post-genomic era. Although site-specific recombination systems have been powerful tools for genome manipulation of many organisms, they have not yet been established for use in the manipulation of the silkworm Bombyx mori genome. In this study, we achieved site-specific excision of a target gene at predefined chromosomal sites in the silkworm using a FLP/FRT site-specific recombination system. We first constructed two stable transgenic target silkworm strains that both contain a single copy of the transgene construct comprising a target gene expression cassette flanked by FRT sites. Using pre-blastoderm microinjection of a FLP recombinase helper expression vector, 32 G3 site-specific recombinant transgenic individuals were isolated from five of 143 broods. The average frequency of FLP recombinase-mediated site-specific excision in the two target strains genome was approximately 3.5%. This study shows that it is feasible to achieve site-specific recombination in silkworms using the FLP/FRT system. We conclude that the FLP/FRT system is a useful tool for genome manipulation in the silkworm. Furthermore, this is the first reported use of the FLP/FRT system for the genetic manipulation of a lepidopteran genome and thus provides a useful reference for the establishment of genome manipulation technologies in other lepidopteran species.

show abstract

“…Tadpoles were genotyped as previously described (Zuber et al, 2012), using primers 5′ (GATGGATTGCACGCAGGTTC) and 3′ (CGATAGAAGGCGATGCGCTGC). To generate tadpoles for analysis, transgenic females were induced to lay eggs and in vitro fertilized with wild-type sperm, while transgenic males were crossed with wild-type females by natural mating as previously described (Klassen et al, 2012; Zuber et al, 2012). All procedures were in accordance with IACUC approved protocols.…”

Section: Methodsmentioning

confidence: 99%

Distinct cis-acting regions control six6 expression during eye field and optic cup stages of eye formation

Ledford

Luna

Theisen

et al. 2017

Developmental Biology

Self Cite

View full text Add to dashboard Cite

The eye field transcription factor, Six6, is essential for both the early (specification and proliferative growth) phase of eye formation, as well as for normal retinal progenitor cell differentiation. While genomic regions driving six6 optic cup expression have been described, the sequences controlling eye field and optic vesicle expression are unknown. Two evolutionary conserved regions 5′ and a third 3′ to the six6 coding region were identified, and together they faithfully replicate the endogenous X. laevis six6 expression pattern. Transgenic lines were generated and used to determine the onset and expression patterns controlled by the regulatory regions. The conserved 3′ region was necessary and sufficient for eye field and optic vesicle expression. In contrast, the two conserved enhancer regions located 5′ of the coding sequence were required together for normal optic cup and mature retinal expression. Gain-of-function experiments indicate endogenous six6 and GFP expression in F1 transgenic embryos are similarly regulated in response to candidate trans-acting factors. Importantly, CRISPR/CAS9-mediated deletion of the 3′ eye field/optic vesicle enhancer in X. laevis, resulted in a reduction in optic vesicle size. These results identify the cis-acting regions, demonstrate the modular nature of the elements controlling early versus late retinal expression, and identify potential regulators of six6 expression during the early stages of eye formation.

show abstract

Site‐specific transgenesis in Xenopus

Cited by 7 publications

References 22 publications

Zebrafish transgenic constructs label specific neurons in Xenopus laevis spinal cord and identify frog V0v spinal neurons

Zebrafish transgenic constructs label specific neurons in Xenopus laevis spinal cord and identify frog V0v spinal neurons

FLP Recombinase-Mediated Site-Specific Recombination in Silkworm, Bombyx mori

Distinct cis-acting regions control six6 expression during eye field and optic cup stages of eye formation

Contact Info

Product

Resources

About