Site-directed mutagenesis of double-stranded DNA by the polymerase chain reaction

Weiner, Michael P.; Costa, Gina L.; Schoettlin, Warren; Cline, Janice; Mathur, Eric J.; Bauer, John C.

doi:10.1016/0378-1119(94)90641-6

Cited by 439 publications

(329 citation statements)

References 23 publications

Supporting

Mentioning

327

Contrasting

Order By: Relevance

“…The forward and reverse primers used in each case had non-complementary XhoI and XbaI sites for positional cloning in the CS2þMT vector. (3) a C-terminal alanine (C'Ala) construct generated by inverse PCR sitedirected mutagenesis, with alanine substitutions in place of the terminal phosphorylatable residues (S164A, T166A, S168A, S170A) in the fulllength telethonin sequence, using primer pairs (forward) 5 0 CTGGCCTG GCCCAAGCCTTCGCCAAGGCTAT GGCTCAAGAGGTCAT 3 0 and (reverse) 5 0 ATGACCTCTTGAGCCA TAGCCTTGGCGAAGGCTTGGGCC AGGCCAG 3 0 (Weiner et al, 1994). For mRNA synthesis, plasmid DNA was linearized using NotI restriction enzyme and exogenous mRNA was synthesized in vitro using mMES-SAGE mMACHINE SP6 kit (Ambion, Austin, TX) as per the manufacturer's instructions.…”

Section: Plasmid Constructionmentioning

confidence: 99%

Distinct roles for telethonin N‐versus C‐terminus in sarcomere assembly and maintenance

Sadikot

Hammond

Ferrari

2010

Developmental Dynamics

View full text Add to dashboard Cite

The N-terminus of telethonin forms a unique structure linking two titin N-termini at the Z-disc. While a specific role for the C-terminus has not been established, several studies indicate it may have a regulatory function. Using a morpholino approach in Xenopus, we show that telethonin knockdown leads to embryonic paralysis, myocyte defects, and sarcomeric disruption. These myopathic defects can be rescued by expressing full-length telethonin mRNA in morpholino background, indicating that telethonin is required for myofibrillogenesis. However, a construct missing C-terminal residues is incapable of rescuing motility or sarcomere assembly in cultured myocytes. We, therefore, tested two additional constructs: one where four C-terminal phosphorylatable residues were mutated to alanines and another where terminal residues were randomly replaced. Data from these experiments support that the telethonin C-terminus is required for assembly, but in a context-dependent manner, indicating that factors and forces present in vivo can compensate for C-terminal truncation or mutation.

show abstract

Section: Plasmid Constructionmentioning

confidence: 99%

Distinct roles for telethonin N‐versus C‐terminus in sarcomere assembly and maintenance

Sadikot

Hammond

Ferrari

2010

Developmental Dynamics

View full text Add to dashboard Cite

show abstract

“…The plasmid constructs with deleted putative DNA -proteinbinding sites ( Figure 3D) were generated by site-directed PCR mutagenesis according to Weiner et al (1994).…”

Section: In Vitro Modifications Of the Graf Promotermentioning

confidence: 99%

Characterisation of the GRAF gene promoter and its methylation in patients with acute myeloid leukaemia and myelodysplastic syndrome

et al. 2006

View full text Add to dashboard Cite

We report the isolation of the 5 0 flanking region of GRAF (GTPase regulator associated with the focal adhesion kinase), previously described as a putative tumour suppressor gene of acute myelogenous leukaemia and myelodysplastic syndrome, and demonstrate its promoter activity in reporter gene assays. Two putative protein-binding sites are identified of which one was sensitive to CpG methylation. The suppressed GRAF expression could be restored in leukaemia cell lines by treatment with a demethylating agent and an inhibitor of histone deacetylases. In contrast to normal tissues, which tested negative for GRAF promoter methylation, 11 of 29 (38%) bone marrow samples from patients with acute myeloid leukaemia or myelodysplastic syndrome were positive.

show abstract

“…This plasmid was used as template to mutate the putative regulatory elements by sitedirected mutagenesis via inverse PCR (Weiner et al, 1994). Primers used to introduce mutation in the STRE1, STRE2, PDS, HAP1 and HAP2 elements are indicated in Table 1.…”

Section: Plasmids and Site-directed Mutagenesismentioning

confidence: 99%

HXT5 expression is under control of STRE and HAP elements in the HXT5 promoter

Verwaal

Arako

Kapur

et al. 2004

Yeast

View full text Add to dashboard Cite

Hexose transporter (Hxt) proteins transport glucose across the plasma membrane in the yeast Saccharomyces cerevisiae. Recently, we have shown that expression of HXT5 is regulated by the growth rate of the cells. Because gene expression is regulated by binding of specific transcription factors to regulatory elements in the promoters of genes, the presence of putative regulatory elements in the promoter of HXT5 was determined by computer-assisted analysis. This revealed the presence of two putative stress-responsive elements (STREs), one putative post-diauxic shift (PDS) element and two putative Hap2/3/4/5p (HAP) complex binding elements. The involvement of these elements was studied by using mutations in a HXT5 promoter-LacZ fusion construct. Growth during various conditions that result in low growth rates of yeast cells revealed that the STRE most proximal to the translation initiation site seemed to be involved in particular in regulation of HXT5 expression during growth at decreased growth rates. In addition, the HAP elements seemed to be required during growth on non-fermentable carbon sources. The PDS element and, to a lesser extent, the other STRE showed particular involvement in regulation of HXT5 expression during growth on ethanol. Finally, it was shown that the PKA pathway, which is known to be involved in expression of STRE-regulated genes, was also involved in regulation of HXT5 expression. A possible mechanism by which expression of HXT5 could be regulated by the transcriptional regulatory elements in the promoter is discussed.

show abstract

Site-directed mutagenesis of double-stranded DNA by the polymerase chain reaction

Cited by 439 publications

References 23 publications

Distinct roles for telethonin N‐versus C‐terminus in sarcomere assembly and maintenance

Distinct roles for telethonin N‐versus C‐terminus in sarcomere assembly and maintenance

Characterisation of the GRAF gene promoter and its methylation in patients with acute myeloid leukaemia and myelodysplastic syndrome

HXT5 expression is under control of STRE and HAP elements in the HXT5 promoter

Contact Info

Product

Resources

About