Single-Primer Amplification of Flanking Sequences

Hermann, S. R.; Miller, J. A.; O'Neill, Sarah; Tsao, Theresa Tsun-Hui; Harding, Robert M.; Dale, James L.

doi:10.2144/00296bm04

Cited by 23 publications

(18 citation statements)

References 6 publications

(10 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The Tn917 insertion site in the attenuated mutant TnM2 was identified by direct sequencing from genomic DNA using the modified primer (fimer) 5Ј-GAAACATTGGTTTAGTGGGAATTTGTAC-3Ј and 0.1 l of Thermofidelase (Fidelity Systems) in a 20-l cycle sequencing reaction mixture (Big Dye v3.0; Applied Biosystems, Inc.). Chromosome walking using a single-primer PCR technique was used to discover the entire sequence of pgm and flanking regions (17,18). Sequence files were analyzed with Chromas (Technelysium, Tewantin, Australia), aligned with BioEdit (Ibis Therapeutics, Carlsbad, CA), and annotated with Artemis, version 5.0 (Sanger Institute, Cambridge, United Kingdom).…”

Section: Methodsmentioning

confidence: 99%

Streptococcus iniae Phosphoglucomutase Is a Virulence Factor and a Target for Vaccine Development

Buchanan¹,

et al. 2005

View full text Add to dashboard Cite

Streptococcus iniae represents a major health and economic problem in fish species worldwide. Random Tn917 mutagenesis and high-throughput screening in a hybrid striped bass (HSB) model of meningoencephalitis identified attenuated S. iniae mutants. The Tn917 insertion in one mutant disrupted an S. iniae homologue of a phosphoglucomutase (pgm) gene. Electron microscopy revealed a decrease in capsule thickness and cell wall rigidity, with ⌬PGM mutant cells reaching sizes ϳ3-fold larger than those of the wild type (WT). The ⌬PGM mutant was cleared more rapidly in HSB blood and was more sensitive to killing by cationic antimicrobial peptides including moronecidin from HSB. In vivo, the ⌬PGM mutant was severely attenuated in HSB, as intraperitoneal challenge with 1,000 times the WT lethal dose produced only 2.5% mortality. Reintroduction of an intact copy of the S. iniae pgm gene on a plasmid vector restored antimicrobial peptide resistance and virulence to the ⌬PGM mutant. In analysis of the aborted infectious process, we found that ⌬PGM mutant organisms initially disseminated to the blood, brain, and spleen but were eliminated by 24 h without end organ damage. Ninety to 100% of fish injected with the ⌬PGM mutant and later challenged with a lethal dose of WT S. iniae survived. We conclude that the pgm gene is required for virulence in S. iniae, playing a role in normal cell wall morphology, surface capsule expression, and resistance to innate immune clearance mechanisms. An S. iniae ⌬PGM mutant is able to stimulate a protective immune response and may have value as a live attenuated vaccine for aquaculture.With increased development of intensive operations, disease has become a significant hurdle to the profitable culture of fish and shellfish. Streptococcal infections in fish, in particular those produced by the pathogen Streptococcus iniae, have increased markedly with intensification of aquaculture practices (37). S. iniae causes a fatal meningoencephalitis and is associated with large-scale mortality in a wide variety of marine and freshwater cultured fish species, as well as in wild species (5,39,46). More than 30 species of fish have documented susceptibility to S. iniae disease, including trout (10), yellowtail (19), tilapia (39), barramundi (6), and hybrid striped bass (HSB) (11). S. iniae is distributed globally and is estimated to cause yearly economic losses of hundreds of millions of dollars. Occasionally, S. iniae can cause serious zoonotic infections in humans who injure themselves while handling infected fish (20,42).Relatively little is known of the genetics of S. iniae or of the pathogenic mechanisms underlying its virulence. Here, we describe a severely attenuated mutant of S. iniae, identified through random transposon mutagenesis and direct screening for virulence in HSB. Analysis of the transposon insertion site revealed a disruption of an open reading frame (ORF) with similarity to bacterial phosphoglucomutase (pgm) genes. The enzyme phosphoglucomutase (PGM) interconverts glucose-6-phosphate an...

show abstract

Section: Methodsmentioning

confidence: 99%

Streptococcus iniae Phosphoglucomutase Is a Virulence Factor and a Target for Vaccine Development

Buchanan¹,

et al. 2005

View full text Add to dashboard Cite

show abstract

“…Nile tilapia GHR2: The primer scGHR1-R1 was used to obtain a fragment of the Nile tilapia GHR2 using a single primer approach (Parks et al 1991, Hermann et al 2000. For 3 RACE, the first round of PCR was performed using ntGHR2-F2 and CDSIII/3 PCR as primers, followed by a nested PCR using ntGHR2-F3 and CDSIII/3 PCR as primers.…”

Section: Isolation Of Full-length Ghr1 and Ghr2 Cdna Sequences From Smentioning

confidence: 99%

The co-existence of two growth hormone receptors in teleost fish and their differential signal transduction, tissue distribution and hormonal regulation of expression in seabream

Jiao

Huang²,

Chan³

et al. 2006

Journal of Molecular Endocrinology

148

View full text Add to dashboard Cite

Two genomic contigs of putative growth hormone receptors (GHRs) were identified in fugu and zebrafish genomes by in silico analysis, suggesting the presence of two GHR subtypes in a single teleost species. We have tested this hypothesis by cloning the full-length cDNA sequence of a second GHR subtype from the black seabream in which the first GHR subtype had been previously reported by us. In addition, we had also cloned the sequences of both GHR subtypes from two other fish species, namely the Southern catfish and the Nile tilapia. Phylogenetic analysis of known GHR sequences from various vertebrates revealed that fish GHRs cluster into two distinct clades, viz. GHR1 and GHR2. One clade (GHR1), containing 6 to 7 extracellular cysteine residues, is structurally more akin to the non-teleost GHRs. The other clade (GHR2), containing only 4 to 5 extracellular cysteine residues, is unique to teleosts and is structurally more divergent from the non-teleost GHRs. In addition, we had examined the biological activities of both GHR subtypes from seabream using a number of reporter transcription assays in cultured eukaryotic cells and demonstrated that both of them were able to activate the Spi 2·1 and -casein promoters upon receptor stimulation in a ligand specific manner. In contrast, only GHR1 but not GHR2 in seabream could trigger the c-fos promoter activity, indicating that the two GHR subtypes possess some differences in their signal transduction mechanisms. Also, the expression of GHR2 is significantly higher than GHR1 in many tissues of the seabream including the gonad, kidney, muscle, pituitary and spleen. In vivo hormone treatment data indicated that cortisol upregulated hepatic GHR1 expression in seabream but not GHR2, whereas testosterone decreased hepatic GHR2 expression but not GHR1. On the other hand, hepatic expression of both GHR1 and GHR2 in seabream was decreased by estradiol treatment.

show abstract

“…Insertions of Tn10dTc and T-POP were localized by sequencing a single-primer PCR product that included the junction of the element and the adjacent chromosomal sequence, as described previously (14). Primer TP93 (ACCTTTGGTCACCAACGCTTTTCC) primed outward-directed synthesis from the ends of the Tn10dTc and T-POP elements; the same primer initiated synthesis at low stringency in the opposite direction from random sites.…”

Section: Methodsmentioning

confidence: 99%

“…Cells were grown in 100-ml LB cultures at 37°C to an optical density at 600 nm of 0.6 and resuspended in 2 ml of saline. The NMN phosphatase activity was confirmed using [carbonyl- 14 C]NMN that was prepared by pyrophosphorolysis of [carbonyl-…”

Section: Methodsmentioning

confidence: 99%

Assimilation of Nicotinamide Mononucleotide Requires Periplasmic AphA Phosphatase inSalmonella enterica

Grose

Bergthorsson

et al. 2005

J Bacteriol

View full text Add to dashboard Cite

Salmonella enterica can obtain pyridine from exogenous nicotinamide mononucleotide (NMN) by three routes. In route 1, nicotinamide is removed from NMN in the periplasm and enters the cell as the free base. In route 2, described here, phosphate is removed from NMN in the periplasm by acid phosphatase (AphA), and the produced nicotinamide ribonucleoside (NmR) enters the cell via the PnuC transporter. Internal NmR is then converted back to NMN by the NmR kinase activity of NadR. Route 3 is seen only in pnuC* transporter mutants, which import NMN intact and can therefore grow on lower levels of NMN. Internal NMN produced by either route 2 or route 3 is deamidated to nicotinic acid mononucleotide and converted to NAD by the biosynthetic enzymes NadD and NadE.

show abstract

Single-Primer Amplification of Flanking Sequences

Cited by 23 publications

References 6 publications

Streptococcus iniae Phosphoglucomutase Is a Virulence Factor and a Target for Vaccine Development

Streptococcus iniae Phosphoglucomutase Is a Virulence Factor and a Target for Vaccine Development

The co-existence of two growth hormone receptors in teleost fish and their differential signal transduction, tissue distribution and hormonal regulation of expression in seabream

Assimilation of Nicotinamide Mononucleotide Requires Periplasmic AphA Phosphatase inSalmonella enterica

Contact Info

Product

Resources

About