Simultaneous quantification of mitochondrial DNA copy number and deletion ratio: A multiplex real-time PCR assay

Phillips, Nicole; Sprouse, Marc L.; Roby, Rhonda K.

doi:10.1038/srep03887

Cited by 142 publications

(114 citation statements)

References 40 publications

Supporting

Mentioning

108

Contrasting

Unclassified

Order By: Relevance

“…mtDNA was quantified with real-time polymerase chain reaction with the following primers: mtDNA F: CTAAATAGCCCACACGTTCCC; R: AGAGCTCCCGTGAGTGGTTA (targeting a relatively stable site in mitochondrial DNA minimal arc [16]), and nuclear DNA F: GCTGGGTAGCTCTAAACAATGTATTCA; R: CCATGTACTAACAAATGTCTAAAATGGT (targeting single-copy nuclear DNA within the beta-2M gene [16]), using SYBR Green PCR Master Mix and the 7000 Sequence Detection System (Applied Biosystems, Foster City, California). The relative mtDNA copy number was calculated from the ratio of mtDNA copies to nuclear DNA copies per gram of tissue.…”

Section: Methodsmentioning

confidence: 99%

Human Ventricular Unloading Induces Cardiomyocyte Proliferation

Canseco

Kimura

Garg

et al. 2015

Journal of the American College of Cardiology

118

106

View full text Add to dashboard Cite

Background The adult mammalian heart is incapable of meaningful regeneration after substantial cardiomyocyte loss, primarily due to the inability of adult cardiomyocytes to divide. Our group recently showed that mitochondria-mediated oxidative DNA damage is an important regulator of postnatal cardiomyocyte cell cycle arrest. However, it is not known whether mechanical load also plays a role in this process. We reasoned that the postnatal physiological increase in mechanical load contributes to the increase in mitochondrial content, with subsequent activation of DNA damage response (DDR) and permanent cell cycle arrest of cardiomyocytes. Objectives The purpose of this study was to test the effect of mechanical unloading on mitochondrial mass, DDR, and cardiomyocyte proliferation. Methods We examined the effect of human ventricular unloading after implantation of left ventricular assist devices (LVADs) on mitochondrial content, DDR, and cardiomyocyte proliferation in 10 matched left ventricular samples collected at the time of LVAD implantation (pre-LVAD) and at the time of explantation (post-LVAD). Results We found that post-LVAD hearts showed up to a 60% decrease in mitochondrial content and up to a 45% decrease in cardiomyocyte size compared with pre-LVAD hearts. Moreover, we quantified cardiomyocyte nuclear foci of phosphorylated ataxia telangiectasia mutated protein, an upstream regulator of the DDR pathway, and we found a significant decrease in the number of nuclear phosphorylated ataxia telangiectasia mutated foci in the post-LVAD hearts. Finally, we examined cardiomyocyte mitosis and cytokinesis and found a statistically significant increase in both phosphorylated histone H3-positive, and Aurora B-positive cardiomyocytes in the post-LVAD hearts. Importantly, these results were driven by statistical significance in hearts exposed to longer durations of mechanical unloading. Conclusions Prolonged mechanical unloading induces adult human cardiomyocyte proliferation, possibly through prevention of mitochondria-mediated activation of DDR.

show abstract

Section: Methodsmentioning

confidence: 99%

Human Ventricular Unloading Induces Cardiomyocyte Proliferation

Canseco

Kimura

Garg

et al. 2015

Journal of the American College of Cardiology

118

106

View full text Add to dashboard Cite

show abstract

“…More commonly employed technologies are quantitative real-time polymerase chain reaction (qPCR) and sequencing platforms, especially next generation sequencing (NGS). Both methods yield one value for mtDNA and one value for nuclear DNA (nDNA) quantity, and the ratio of mtDNA to nDNA is the principal mode to assess mtDNA quantity per cell (9). Crucially, using nDNA values for normalization assumes that the composition of nDNA is equal across samples.…”

Section: Introductionmentioning

confidence: 99%

Accurate Quantitation of Mitochondrial DNA Reveals Uniform Levels in Human Blastocysts Irrespective of Ploidy, Age, or Implantation Potential

Victor

Brake

Tyndall

et al. 2017

Obstetrical &Amp; Gynecological Survey

View full text Add to dashboard Cite

Main Outcome Measure(s): For each sample the mtDNA value was divided by the nuclear DNA (nDNA) value and the result was further subjected to mathematical analysis tailored to the genetic makeup of the source embryo.Result(s): On average the mathematical correction factor changed the conventionally determined mtDNA score of a given blastocyst via NGS by 1.43% +/-1.59% (N=1396), with maximal adjustments of 17.42%, and via qPCR by 1.33% +/-8.08% (N=150), with maximal adjustments of 50.00%. Levels of mtDNA in euploid and aneuploid embryos showed a statistically insignificant difference by NGS (euploids N=775, aneuploids N=621) and by qPCR (euploids N=100, aneuploids N=50). Blastocysts derived from younger or older patients had comparable mtDNA levels by NGS ( N=874 age group N=514) and by qPCR ( N age group N=58). Viable blastocysts did not contain significantly different mtDNA levels compared to unviable blastocysts when analyzed by NGS (implanted N=101, nonimplanted N=140) and by qPCR (implanted N=49, non-implanted N=51). Conclusion(s):We recommend implementation of the correction factor calculation to laboratories evaluating mtDNA levels in embryos by NGS or qPCR. When applied to our in-house data, the calculation reveals that overall levels of mtDNA are largely equal between blastocysts stratified by ploidy, age, or implantation potential.

show abstract

“…Depending on the extraction procedure, this may be done by determining the copy number of a cellular gene such as β-globin76 or β-actin 82. If smaller DNAs were enriched over larger DNAs, as in the Hirt procedure,83 mitochondrial DNA may be used for an approximation,84 85 although the variable number of mitochondrial genomes per cell needs to be considered 86…”

Section: The Challenge Of Unambiguous Human Hbv Cccdna Detectionmentioning

confidence: 99%

HBV cccDNA: viral persistence reservoir and key obstacle for a cure of chronic hepatitis B

Nassal

2015

Gut

721

713

View full text Add to dashboard Cite

At least 250 million people worldwide are chronically infected with HBV, a small hepatotropic DNA virus that replicates through reverse transcription. Chronic infection greatly increases the risk for terminal liver disease. Current therapies rarely achieve a cure due to the refractory nature of an intracellular viral replication intermediate termed covalently closed circular (ccc) DNA. Upon infection, cccDNA is generated as a plasmid-like episome in the host cell nucleus from the protein-linked relaxed circular (RC) DNA genome in incoming virions. Its fundamental role is that as template for all viral RNAs, and in consequence new virions. Biosynthesis of RC-DNA by reverse transcription of the viral pregenomic RNA is now understood in considerable detail, yet conversion of RC-DNA to cccDNA is still obscure, foremostly due to the lack of feasible, cccDNA-dependent assay systems. Conceptual and recent experimental data link cccDNA formation to cellular DNA repair, which is increasingly appreciated as a critical interface between cells and viruses. Together with new in vitro HBV infection systems, based on the identification of the bile acid transporter sodium taurocholate cotransporting polypeptide as an HBV entry receptor, this offers novel opportunities to decipher, and eventually interfere with, formation of the HBV persistence reservoir. After a brief overview of the role of cccDNA in the HBV infectious cycle, this review aims to summarise current knowledge on cccDNA molecular biology, to highlight the experimental restrictions that have hitherto hampered faster progress and to discuss cccDNA as target for new, potentially curative therapies of chronic hepatitis B.

show abstract

Simultaneous quantification of mitochondrial DNA copy number and deletion ratio: A multiplex real-time PCR assay

Cited by 142 publications

References 40 publications

Human Ventricular Unloading Induces Cardiomyocyte Proliferation

Human Ventricular Unloading Induces Cardiomyocyte Proliferation

Accurate Quantitation of Mitochondrial DNA Reveals Uniform Levels in Human Blastocysts Irrespective of Ploidy, Age, or Implantation Potential

HBV cccDNA: viral persistence reservoir and key obstacle for a cure of chronic hepatitis B

Contact Info

Product

Resources

About