Simultaneous monitoring and quantification of <i>Melampsora allii‐populina</i> and <i>Melampsora larici‐populina</i> on infected poplar leaves using a duplex real‐time <scp>PCR</scp> assay

Guinet, Cécile; Boutigny, Anne-Laure; Vialle, Agathe; Hamelin, Richard; Frey, Pascal; Ioos, Renaud

doi:10.1111/ppa.12426

Cited by 8 publications

(9 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Real-time PCR was also used to assess the presence of two fungal species from the mock community in both sets of samples (unexposed and exposed). Specific primer-probe combinations designed to specifically detect Hymenoscyphus fraxineus (by Ioos et al [63]) and Melampsora larici-populina (by Guinet et al [64]) were used according to the mix conditions and PCR parameters described by the authors. Real-time PCR was used to verify the presence or absence of these target fungi.…”

Section: Preparation Of a Mock Community Fungal Cultures Were Obtainmentioning

confidence: 99%

Assessment of Passive Traps Combined with High-Throughput Sequencing To Study Airborne Fungal Communities

Aguayo¹,

Fourrier‐Jeandel²,

Husson

et al. 2018

Appl Environ Microbiol

View full text Add to dashboard Cite

Techniques based on high-throughput sequencing (HTS) of environmental DNA have provided a new way of studying fungal diversity. However, these techniques suffer from a number of methodological biases which may appear at any of the steps involved in a metabarcoding study. Air is one of the most important environments where fungi can be found, because it is the primary medium of dispersal for many species. Looking ahead to future developments, it was decided to test 20 protocols, including different passive spore traps, spore recovery procedures, DNA extraction kits, and barcode loci. HTS was performed with the Illumina MiSeq platform targeting two subloci of the fungal internal transcribed spacer. Multivariate analysis and generalized linear models showed that the type of passive spore trap, the spore recovery procedure, and the barcode all impact the description of fungal communities in terms of richness and diversity when assessed by HTS metabarcoding. In contrast, DNA extraction kits did not significantly impact these results. Although passive traps may be used to describe airborne fungal communities, a study using specific real-time PCR and a mock community showed that these kinds of traps are affected by environmental conditions that may induce losses of biological material, impacting diversity and community composition results. The advent of high-throughput sequencing (HTS) methods, such as those offered by next-generation sequencing (NGS) techniques, has opened a new era in the study of fungal diversity in different environmental substrates. In this study, we show that an assessment of the diversity of airborne fungal communities can reliably be achieved by the use of simple and robust passive spore traps. However, a comparison of sample processing protocols showed that several methodological biases may impact the results of fungal diversity when assessed by metabarcoding. Our data suggest that identifying these biases is of paramount importance to enable a correct identification and relative quantification of community members.

show abstract

Section: Preparation Of a Mock Community Fungal Cultures Were Obtainmentioning

confidence: 99%

Assessment of Passive Traps Combined with High-Throughput Sequencing To Study Airborne Fungal Communities

Aguayo¹,

Fourrier‐Jeandel²,

Husson

et al. 2018

Appl Environ Microbiol

View full text Add to dashboard Cite

show abstract

“…In order to quantify M. larici-populina mycelium in planta , quantitative Taqman ® PCR was performed using new primers and probe designed for the rDNA ITS (Internal Transcribed Spacer). These primers and probe allowed a significant gain in sensitivity compared to a previously used primer pair, which was designed for a single-copy gene ( Guinet et al, 2016 ). Reagent mix contained 3.1 μL of pure water, 6.5 μL of Mastermix ® , 0.13 μL of primer ITS-Mlp-F (Primer sequence 5′-3′: TGACTCTTTGTATAAACCATTACCC), 0.13 μL of primer ITS-Mlp-R (TCAAAGTTGCCTTTGAGATACG), and 0.13 μL of probe ITS-Mlp-P (6-FAM-TGCATTGTGGCCCGTCAAAA-BHQ1) per sample.…”

Section: Methodsmentioning

confidence: 99%

Defense Compounds Rather Than Nutrient Availability Shape Aggressiveness Trait Variation Along a Leaf Maturity Gradient in a Biotrophic Plant Pathogen

et al. 2018

View full text Add to dashboard Cite

Foliar pathogens face heterogeneous environments depending on the maturity of leaves they interact with. In particular, nutrient availability as well as defense levels may vary significantly, with opposing effects on the success of infection. The present study tested which of these factors have a dominant effect on the pathogen’s development. Poplar leaf disks of eight maturity levels were inoculated with the poplar rust fungus Melampsora larici-populina using an innovative single-spore inoculation procedure. A set of quantitative fungal traits (infection efficiency, latent period, uredinia size, mycelium quantity, sporulation rate, sporulation capacity, and spore volume) was measured on each infected leaf disk. Uninfected parts of the leaves were analyzed for their nutrient (sugars, total C and N) and defense compounds (phenolics) content. We found that M. larici-populina is more aggressive on more mature leaves as indicated by wider uredinia and a higher sporulation rate. Other traits varied independently from each other without a consistent pattern. None of the pathogen traits correlated with leaf sugar, total C, or total N content. In contrast, phenolic contents (flavonols, hydroxycinnamic acid esters, and salicinoids) were negatively correlated with uredinia size and sporulation rate. The pathogen’s fitness appeared to be more constrained by the constitutive plant defense level than limited by nutrient availability, as evident in the decrease in sporulation.

show abstract

“…The most important rusts within forests are the rusts of pine stems and cones [30] which are caused by the Melampsora spp. Castagne, which is a macrocyclic (producing five types of spores during the life cycle) and heteroic (requiring two hosts to complete its life cycle) fungus.…”

Section: Rustsmentioning

confidence: 99%

“…These rusts often affect several host species of the genus Populus L. and other trees of the Salicaceae family, including various poplars, aspens, and willows throughout the world. The disease is caused by several species of the genus Melampsora, including M. larici-populina (mainly in Europe), and M. medusa and M. occidentalis (in North America) [30]. Tree pathogens present in the soil also include Rhizoctonia spp.…”

Section: Rustsmentioning

confidence: 99%

The Threat of Pests and Pathogens and the Potential for Biological Control in Forest Ecosystems

Balla

Silini

Cherif‐Silini

et al. 2021

Forests

View full text Add to dashboard Cite

Forests are an essential component of the natural environment, as they support biodiversity, sequester carbon, and play a crucial role in biogeochemical cycles—in addition to producing organic matter that is necessary for the function of terrestrial organisms. Forests today are subject to threats ranging from natural occurrences, such as lightning-ignited fires, storms, and some forms of pollution, to those caused by human beings, such as land-use conversion (deforestation or intensive agriculture). In recent years, threats from pests and pathogens, particularly non-native species, have intensified in forests. The damage, decline, and mortality caused by insects, fungi, pathogens, and combinations of pests can lead to sizable ecological, economic, and social losses. To combat forest pests and pathogens, biocontrol may be an effective alternative to chemical pesticides and fertilizers. This review of forest pests and potential adversaries in the natural world highlights microbial inoculants, as well as research efforts to further develop biological control agents against forest pests and pathogens. Recent studies have shown promising results for the application of microbial inoculants as preventive measures. Other studies suggest that these species have potential as fertilizers.

show abstract

Simultaneous monitoring and quantification of Melampsora allii‐populina and Melampsora larici‐populina on infected poplar leaves using a duplex real‐time PCR assay

Cited by 8 publications

References 37 publications

Assessment of Passive Traps Combined with High-Throughput Sequencing To Study Airborne Fungal Communities

Assessment of Passive Traps Combined with High-Throughput Sequencing To Study Airborne Fungal Communities

Defense Compounds Rather Than Nutrient Availability Shape Aggressiveness Trait Variation Along a Leaf Maturity Gradient in a Biotrophic Plant Pathogen

The Threat of Pests and Pathogens and the Potential for Biological Control in Forest Ecosystems

Contact Info

Product

Resources

About