Simple and reliable system for transient gene expression for the characteristic signal sequences and the estimation of the localization of target protein in plant cell

Tyurin, A. A.; Кабардаева, К. В.; Berestovoy, M. A.; Sidorchuk, Yu. V.; Фоменков, А. А.; Носов, А. В.; Goldenkova-Pavlova, I. V.

doi:10.1134/s1021443717040173

Cited by 8 publications

(20 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…First, the nucleotide sequence of the desC gene encoding the Δ9 acyl-lipid desaturase of Synechocystis vulcanus was obtained by means of PCR using the pQE-desC plasmid (Maali et al 2007) as a template, the GGGCCCACATCATCCTTAGAA sequence as a forward primer (F1), and the GAATTCGGACAACGCTTTGGG sequence as a reverse primer (R1), with the ApaI and EcoRI restriction sites introduced into the forward and reverse primers, respectively. The PCR product was cloned into the pPGG vector (Vyacheslavova et al 2012) preliminarily hydrolyzed at the ApaI and EcoRI sites to obtain the pPGG-D9 vector. The desC-egfp hybrid gene was constructed in the following steps.…”

Section: Engineering Of Plant Expression Vectorsmentioning

confidence: 99%

“…The pVIG-D9 plant expression vector carrying the desC gene was obtained by cloning the SacI-XbaI fragment of the pPGG-D9 plasmid into the pVIG-Т 1A vector (Vyacheslavova et al 2012) preliminarily hydrolyzed at the ApaI and SmaI sites. The pVIG-D9E plant expression vector carrying the desC-egfp hybrid gene was obtained by cloning the ApaI-SmaI fragment of the pPGG-D9E plasmid into the pVIG-Т 1A vector (Vyacheslavova et al 2012) preliminarily hydrolyzed at the ApaI and SmaI sites.…”

Section: Engineering Of Plant Expression Vectorsmentioning

confidence: 99%

“…The plant expression vector carrying the desC gene fused with the sequence for the transit peptide of the small chain of RuBisCO (Lch) of Arabidopsis thaliana (gene ats1A, NCBI, X13611) was obtained in several steps. At the first step, the Lch sequence encoding the transit peptide of the RuBisCO small chain was obtained by means of PCR using the pVIG-S2B plasmid (Vyacheslavova et al 2012) as a template, the GGTACCATGGCTTCTATGATATC sequence as a forward primer (F3), and the GGGCCCCTGATATTCAACTATAT sequence as a reverse primer (R3), with the KpnI and ApaI restriction sites introduced into the forward and reverse primers, respectively. At the second step, the PCR product was cloned into the pVIG-D9 vector preliminarily hydrolyzed at the KpnI and ApaI sites to obtain the pVIG-Lch-D9 vector.…”

Section: Engineering Of Plant Expression Vectorsmentioning

confidence: 99%

“…The pVIG-E expression vector carrying the egfp gene of GFP obtained earlier was used as a control (Vyacheslavova et al 2012).…”

Section: Engineering Of Plant Expression Vectorsmentioning

confidence: 99%

“…Protoplasts were isolated from the leaf fragments with fluorescent areas as described earlier (Tyurin et al 2017, Berestovoy et al 2018. The fluorescence in protoplasts was recorded using an Axio Imager Z2 (Zeiss, Oberkochen, Germany) microscope equipped with an AxioCam MR digital camera and filters No.…”

Section: Protoplast Isolation and Fluorescence Microscopymentioning

confidence: 99%

See 4 more Smart Citations

Altered fatty acid composition of Nicotiana benthamiana and Nicotiana excelsior leaves under transient overexpression of the cyanobacterial desC gene

Berestovoy¹,

Pavlenko²,

Tyurin³

et al. 2020

Biol. plant.

View full text Add to dashboard Cite

Transient heterologous gene expression in two model plant species, Nicotiana benthamiana and N. excelsior, has been used to study the localization of the heterologous Δ9 acyl-lipid desaturase (Δ9 desaturase) of Synechococcus vulcanus in different cell compartments and its functional activity in the cases of the cytosol, chloroplast, and endoplasmic reticulum (ER) localization. The functional activity and substrate specificity of the heterologous desaturase under the conditions of transient expression have been confirmed by comparison of fatty acid (FA) profiles. The Δ9 desaturase, responsible for the synthesis of oleic and palmitoleic acids, has also been shown to strongly promote the accumulation of polyunsaturated FAs. The results convincingly demonstrate that the Δ9 desaturase of the thermophilic cyanobacterium transiently expressed in two Nicotiana species considerably alters lipid metabolism in their leaves towards a higher FA unsaturation. The functional activity of Δ9 desaturase depends on both the model plant species, N. benthamiana or N. excelsior, and the cellular localization of the enzyme. The method of transient expression of heterologous genes in plants is highly effective, inexpensive, and not time-consuming, which makes it attractive for estimating the functional activity and/or substrate specificity of heterologous desaturases.

show abstract

Section: Engineering Of Plant Expression Vectorsmentioning

confidence: 99%

Section: Engineering Of Plant Expression Vectorsmentioning

confidence: 99%

Section: Engineering Of Plant Expression Vectorsmentioning

confidence: 99%

“…The pVIG-E expression vector carrying the egfp gene of GFP obtained earlier was used as a control (Vyacheslavova et al 2012).…”

Section: Engineering Of Plant Expression Vectorsmentioning

confidence: 99%

Section: Protoplast Isolation and Fluorescence Microscopymentioning

confidence: 99%

See 3 more Smart Citations

Altered fatty acid composition of Nicotiana benthamiana and Nicotiana excelsior leaves under transient overexpression of the cyanobacterial desC gene

Berestovoy¹,

Pavlenko²,

Tyurin³

et al. 2020

Biol. plant.

View full text Add to dashboard Cite

show abstract

A high throughput assay of lichenase activity with Congo red dye in plants

et al. 2021

View full text Add to dashboard Cite

Background Since the beginning of the use of reporter proteins for expression analysis, a variety of approaches have been developed and proposed; both qualitative and quantitative. The lack of simple methods for direct observation of gene expression in living organisms makes it necessary to continue to propose new methods. In this work, we consider a method for the quantitative analysis of the expression of thermostable lichenase from Clostridium thermocellum used as a sensitive reporter protein. Results In this study, we report the design a high throughput fluorometric method for quantification of thermostable lichenase C. thermocellum using Congo red and further experimental verification of its relevance and efficiency in assessment of the functional role of regulatory sequences in the plant cell. Conclusions The specific interaction between the dye Congo red and $$\beta$$ β -d-glucans formed the background for designing a high-throughput fluorometric assay for quantification of C. thermocellum thermostable lichenase as a reporter protein for plants. This assay (i) makes it possible to precisely measure the amount of reporter protein in a plant sample; (ii) has shown a high sensitivity for quantification of thermostable lichenase; (iii) is more time- and cost-efficient as compared with the Somogyi–Nelson assay; and (iv) is to the least degree dependent on the presence of the tested buffer components as compared with the Somogyi–Nelson assay.

show abstract

TRANSIENT EXPRESSION OF REPORTER GENES IN CULTIVARS OF Amaranthus caudatus L.

Yaroshko¹

2021

Biotechnol. acta

View full text Add to dashboard Cite

Local cultivars of A. caudatus: Helios and Karmin were used as plant material. Amaranth is a new pseudocereal introduced in Ukraine. The plant biomass of amaranth is used in medicine, food industry and cosmetology industry. Aim. The purpose of the work was to identify the optimal conditions for the transient expression of reporter genes in Amaranthus caudatus cultivars. Methods. Biochemical and microscopy methods were used in the following work. Seedlings and adult plants of different age were infiltrated with agrobacterial suspensions separately (genetic vector pCBV19 with a uidA gene and genetic vector pNMD2501 with a gfp gene in Agrobacterium tumefaciens GV3101 strain). Results. Transient expression of the uidA and gfp genes was obtained in amaranth plants after conduction series of experiments. The most intensive transient expression of gfp and uidA genes was observed in seedlings infiltrated at the age of 1 day. The maximum fluorescence of the GFP protein was observed on 5th–6th days. Conclusions. It was shown that the cultivar Helios was more susceptible to agrobacterial infection than the cultivar Karmin. The effectiveness of Agrobacterium mediated transformation was from 16% to 95% for the Helios cultivar and from 12% to 93% for the Karmin cultivar. The obtained results indicate that the studied amaranth cultivars can potentially be used for obtaining transient expression of target genes and synthesizing target proteins in their tissues in the future.

show abstract

Simple and reliable system for transient gene expression for the characteristic signal sequences and the estimation of the localization of target protein in plant cell

Cited by 8 publications

References 24 publications

Altered fatty acid composition of Nicotiana benthamiana and Nicotiana excelsior leaves under transient overexpression of the cyanobacterial desC gene

Altered fatty acid composition of Nicotiana benthamiana and Nicotiana excelsior leaves under transient overexpression of the cyanobacterial desC gene

A high throughput assay of lichenase activity with Congo red dye in plants

TRANSIENT EXPRESSION OF REPORTER GENES IN CULTIVARS OF Amaranthus caudatus L.

Contact Info

Product

Resources

About