Simple and Efficient Methods for Enrichment and Isolation of Endonuclease Modified Cells

Abstract

The advent of Transcription Activator-Like Effector Nucleases (TALENs), and similar technologies such as CRISPR, provide a straightforward and cost effective option for targeted gene knockout (KO). Yet, there is still a need for methods that allow for enrichment and isolation of modified cells for genetic studies and therapeutics based on gene modified human cells. We have developed and validated two methods for simple enrichment and isolation of single or multiplex gene KO's in transformed, immortalized, and human progenitor cells. These methods rely on selection of a phenotypic change such as resistance to a particular drug or ability to grow in a selective environment. The first method, termed co-transposition, utilizes integration of a piggyBac transposon vector encoding a drug resistance gene. The second method, termed co-targeting, utilizes TALENs to KO any gene that when lost induces a selectable phenotype. Using these methods we also show removal of entire genes and demonstrate that TALENs function in human CD34+ progenitor cells. Further, co-transposition can be used to generate conditional KO cell lines utilizing an inducible cDNA rescue transposon vector. These methods allow for robust enrichment and isolation of KO cells in a rapid and efficient manner.

PVT1 dependence in cancer with MYC copy-number increase

“…CRISPR-mediated Δ PVT1 HCT116 cells were then generated using piggyBac co-transposition enrichment as described 36 . Briefly, cells were NEON electroporated with 2 μg each of hCas9 and the 5′ and 3′ PVT1 gRNA in addition to the 500 ng each of PB7 transposase and PB-CAG-Luc (puro) transposon vector.…”

Slit-Robo GTPase-Activating Protein 2 as a metastasis suppressor in osteosarcoma

“…A guide RNA (gRNA) was created to target exon 6 in murine cell lines (gcattgaggagaagcatgtc). A previously described method of co-transposition was used to enhance screening for knockout clones30. Briefly, cells were transfected with 2 μg Cas9 nuclease, 2 μg gRNA, 500 ng CMV-PB7 PiggyBac transposase, and 500 ng CAGG-Luciferase-IRES-GFP-PGK-Puro PiggyBac transposon for resistance to puromycin.…”

“…SRGAP2 cDNA with the human sequence was transferred into the previously described PB-TRE-DEST1-EF1A-rtTA-IRES-Puro by a standard LR Clonase reaction (Thermo Fisher), following manufacturer’s instruction1830. Luciferase control cell lines were created using the same CAGG-Luciferase-IRES-GFP-PGK-Puro PiggyBac transposon for resistance to puromycin used in the knockout cell lines.…”

Using RNA-seq and targeted nucleases to identify mechanisms of drug resistance in acute myeloid leukemia

“…The sequences of guide RNA were placed in pENTR221-U6-gRNA by inverse PCR, as previously described29. hCas9 was purchased from addgene (Plasmid #41815).…”