Silencing of HSulf-2 expression in MCF10DCIS.com cells attenuate ductal carcinoma in situ progression to invasive ductal carcinoma in vivo

Khurana, Ashwani; McKean, Heidi; Kim, Sung Hoon; Mcguire, Jacie; Roberts, Lewis R.; Goetz, Matthew P.; Shridhar, Viji

doi:10.1186/bcr3140

Cited by 15 publications

(14 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We further asked whether depletion of Sulf-2 sensitized cells to apoptosis due to matrix detachment. To address this question, we stably downregulated Sulf-2 in MCF10DCIS cells using lentiviral shRNA targeting Sulf-2 as previously described [15, 16]. NTC cells and Sulf-2 depleted clones (HW13 and HW11) were subjected to matrix detachment for 16 h. Western blot analysis indicates that Sulf-2 depleted cells showed enhanced expression of cleaved PARP compared to NTC clones (Fig.…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Matrix detachment and proteasomal inhibitors diminish Sulf-2 expression in breast cancer cell lines and mouse xenografts

Khurana

Jung-Beom

et al. 2013

Clin Exp Metastasis

Self Cite

View full text Add to dashboard Cite

Sulfatase 2 (Sulf-2) has been previously shown to be upregulated in breast cancer. Sulf-2 removes sulfate moieties on heparan sulfate proteoglycans which in turn modulate heparin binding growth factor signaling. Here we report that matrix detachment resulted in decreased Sulf-2 expression in breast cancer cells and increased cleavage of poly ADP-ribose polymerase. Silencing of Sulf-2 promotes matrix detachment induced cell death in MCF10DCIS cells. In an attempt to identify Sulf-2 specific inhibitor, we found that proteasomal inhibitors such as MG132, Lactacystin and Bortezomib treatment abolished Sulf-2 expression in multiple breast cancer cell lines. Additionally, we show that Bortezomib treatment of MCF10DCIS cell xenografts in mouse mammary fat pads significantly reduced tumor size, caused massive apoptosis and more importantly reduced Sulf-2 levels in vivo. Finally, our immunohistochemistry analysis of Sulf-2 expression in cohort of patient derived breast tumors indicates that Sulf-2 is significantly upregulated in autologous metastatic lesions compared to primary tumors (p < 0.037, Pearson correlation, Chi-Square analysis). In all, our data suggest that Sulf-2 might play an important role in breast cancer progression from ductal carcinoma in situ into an invasive ductal carcinoma potentially by resisting cell death.

show abstract

Section: Resultsmentioning

confidence: 99%

“…Target sequence for Sulf-2 shRNAs (HW11): CAAGGGT TACAAGCAGTGTAA. Lentivirus particles were produced by transient transfection of two different plasmids targeting Sulf-2 (pLKO.1-Sulf-2) and pLKO.1 non-target control (NTC) along with packaging vectors (pVSV-G and pGag/pol) in 293T cells as previously described [16]. …”

Section: Methodsmentioning

confidence: 99%

Matrix detachment and proteasomal inhibitors diminish Sulf-2 expression in breast cancer cell lines and mouse xenografts

Khurana

Jung-Beom

et al. 2013

Clin Exp Metastasis

Self Cite

View full text Add to dashboard Cite

show abstract

“…The target sequences used for SULF2 shRNA constructs were HW11: CAAGGGTTACAAGCAGTGTAA and HW13: CCACAACACCTACACCAACAA. Lentivirus particles were produced by transient transfection of these two different shRNAs targeting HSulf-2 (pLKO.1-HSulf-2) (shSULF2) and pLKO.1 NTC (scrRNA) along with packaging vectors (pVSV-G and pGag/pol) in 293T cells as previously described (18). Huh-7 cells were grown to 80% confluence and infected with lentivirus particles.…”

Section: Methodsmentioning

confidence: 99%

Transcriptional Induction of Periostin by a Sulfatase 2–TGFβ1–SMAD Signaling Axis Mediates Tumor Angiogenesis in Hepatocellular Carcinoma

et al. 2017

View full text Add to dashboard Cite

Existing anti-angiogenic approaches to treat metastatic hepatocellular carcinoma (HCC) are weakly effectual, prompting further study of tumor angiogenesis in this disease setting. Here we report a novel role for the sulfatase 2 (SULF2) in driving HCC angiogenesis. Sulf2-deficient mice (Sulf2 KO) exhibited resistance to diethylnitrosamine-induced HCC and did not develop metastases like wild-type mice (Sulf2 WT). The smaller and less numerous tumors formed in Sulf2 KO mice exhibited a markedly lower microvascular density. In human HCC cells, SULF2 overexpression increased proliferation, adhesion, chemotaxis and endothelial tube formation in a paracrine fashion. Mechanistic analyses identified the extracellular matrix protein periostin (POSTN), a ligand of αvβ3/5 integrins, as an effector function in SULF2-induced angiogenesis. POSTN silencing in HCC cells attenuated SULF2-induced angiogenesis and tumor growth in vivo. The TGFβ1-SMAD pathway was identified as a critical signaling axis between SULF2 and upregulation of POSTN transcription. In clinical specimens of HCC, elevated levels of SULF2 correlated with increased microvascular density, POSTN levels and relatively poorer patient survival. Together, our findings define an important axis controlling angiogenesis in HCC and a mechanistic foundation for rational drug development.

show abstract

“…Progression to invasive breast cancer occurs when tumor cells in DCIS acquire the ability to penetrate their basement membrane and invade the surrounding tissue. 1, 2 This transition from DCIS to invasive ductal carcinoma (IDC) is accompanied by aberrant changes in various biological processes such as matrix remodeling, 3 paracrine signaling, 4 and immune responses 5 that together contribute to increased invasion of cancer cells and their metastasis to distant organs. With the introduction of screening mammography, the rate at which DCIS is diagnosed has increased by more than tenfold over the past decades and as a result, DCIS now accounts for approximately 20% of all breast cancers 6 .…”

Section: Introductionmentioning

confidence: 99%

A microengineered pathophysiological model of early-stage breast cancer

et al. 2015

View full text Add to dashboard Cite

A mounting body of evidence in cancer research suggests that the local microenvironment of tumor cells has a profound influence on cancer progression and metastasis. In vitro studies on the tumor microenvironment and its pharmacological modulation, however, are often hampered by the technical challenges associated with creating physiological cell culture environments that integrate cancer cells with the key components of their native niche such as neighboring cells and extracellular matrix (ECM) to mimic complex microarchitecture of cancerous tissue. Using early-stage breast cancer as a model disease, here we describe a biomimetic microengineering strategy to reconstitute three-dimensional (3D) structural organization and microenvironment of breast tumors in human cell-based in vitro models. Specifically, we developed a microsystem that enabled co-culture of breast tumor spheroids with human mammary ductal epithelial cells and mammary fibroblasts in a compartmentalized 3D microfluidic device to replicate microarchitecture of breast ductal carcinoma in situ (DCIS). We also explored the potential of this breast cancer-on-a-chip system as a drug screening platform by evaluating the efficacy and toxicity of an anticancer drug (paclitaxel). Our microengineered disease model represents the first critical step towards recapitulating pathophysiological complexity of breast cancer, and may serve as an enabling tool to systematically examine the contribution of the breast cancer microenvironment to the progression of DCIS to an invasive form of the disease.

show abstract

Silencing of HSulf-2 expression in MCF10DCIS.com cells attenuate ductal carcinoma in situ progression to invasive ductal carcinoma in vivo

Cited by 15 publications

References 39 publications

Matrix detachment and proteasomal inhibitors diminish Sulf-2 expression in breast cancer cell lines and mouse xenografts

Matrix detachment and proteasomal inhibitors diminish Sulf-2 expression in breast cancer cell lines and mouse xenografts

Transcriptional Induction of Periostin by a Sulfatase 2–TGFβ1–SMAD Signaling Axis Mediates Tumor Angiogenesis in Hepatocellular Carcinoma

A microengineered pathophysiological model of early-stage breast cancer

Contact Info

Product

Resources

About