Silencing of Host Genes Directed by Virus-Derived Short Interfering RNAs in Caenorhabditis elegans

Abstract

bSmall interfering RNAs (siRNAs) processed from viral replication intermediates by RNase III-like enzyme Dicer guide sequence-specific antiviral silencing in fungi, plants, and invertebrates. In plants, virus-derived siRNAs (viRNAs) can target and silence cellular transcripts and, in some cases, are responsible for the induction of plant diseases. Currently it remains unclear whether viRNAs are also capable of modulating the expression of cellular genes in the animal kingdom, although animal virus-encoded microRNAs (miRNAs) are known to guide efficient silencing of host genes, thereby facilitating virus replication. In this report, we showed that viRNAs derived from a modified nodavirus triggered potent silencing of homologous cellular transcripts produced by the endogenous gene or transgene in the nematode worm Caenorhabditis elegans. Like that found in plants, virus-induced gene silencing (VIGS) in C. elegans also involves RRF-1, a worm RNA-dependent RNA polymerase (RdRP) that is known to produce single-stranded secondary siRNAs in a Dicer-independent manner. We further demonstrated that VIGS in C. elegans is inheritable, suggesting that VIGS has the potential to generate profound epigenetic consequences in future generations. Altogether, these findings, for the first time, confirmed that viRNAs have the potential to modulate host gene expression in the animal kingdom. Most importantly, the success in uncoupling the trigger and the target of the antiviral silencing would allow for the exploration of novel features of virus-host interactions mediated by viRNAs in the animal kingdom.

Homologous RIG-I–like helicase proteins direct RNAi-mediated antiviral immunity in C. elegans by distinct mechanisms

“…Total RNA extraction, small RNA enrichment, detection of viral and cellular transcripts, and small RNAs were carried out following protocols described previously (43,46). DNA oligos with sequence ATTGCCGTACTGAACGATCTCA were labeled and used for the detection of miR-58.…”

“…S8). Our recent study has detected RNAi of cellular mRNAs targeted by virus-derived siRNAs in C. elegans (43). Because low levels of FR1gfp-derived viral siRNAs remained detectable in drh-1 mutants (Fig.…”

“…4B), we next determined whether these viral siRNAs were active in RNAi targeting cellular transcripts in the absence of DRH-1. To test this hypothesis, we used a transgenic worm strain carrying a Psur-5::GFP transgene and a previously described replicon transgene, FR1fp, which does not express GFP because of deletion of the 5′-half of the GFP coding sequence but triggers potent silencing of the homologous cellular GFP transcripts (43) (Fig. S9A).…”

Guest list or black list: heritable small RNAs as immunogenic memories

“…Small RNAs targeting viral genomes (viRNA) accumulate in wild type infected worms, but not mutant worms [35,36]. Moreover, it was shown that viRNAs are capable of being transmitted between generations of worms [21,24]. RNAi heterozygous mutant worms, which are functionally competent, can generate anti-viral RNAi immunity that protects their homozygous RNAi-mutant progeny from replication of a transgenic Flock House Virus (FHV) for multiple generations [21].…”

“…Each nematode produces hundreds of progeny, and therefore small RNAs must be amplified to overcome the transgenerational dilution effect that expands logarithmically. Indeed, in worms which are mutants for the RdRP RRF-1, inherited RNAi diminishes after 2 generations, indicating the RNA amplification is required for long-term transgenerational RNAi effects [21,24]. In addition, it was recently demonstrated that the RRF-1 RdRP is required for effective transgenerational targeting of chromatin [25].…”