Shifts in the Community Dynamics and Activity of Ammonia‐Oxidizing Prokaryotes Along the Yangtze Estuarine Salinity Gradient

Gao, Juan; Hou, Lijun; Liu, Min; Yin, Guoyu; Yu, Chendi; Gao, Dengzhou

doi:10.1029/2017jg004182

Cited by 21 publications

(9 citation statements)

References 69 publications

(98 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Pearson correlation analyses were conducted to test correlations between diversity, abundance and environmental factors. One-way analysis of variance (ANOVA) tests were performed to compare PNRs rates ( Gao et al, 2016a ). Significance for all tests was accepted at p ≤ 0.05.…”

Section: Methodsmentioning

confidence: 99%

Distribution and Diversity of Comammox Nitrospira in Coastal Wetlands of China

et al. 2020

Self Cite

View full text Add to dashboard Cite

Complete ammonia oxidizers (comammox), able to individually oxidize ammonia to nitrate, are considered to play a significant role in the global nitrogen cycle. However, the distribution of comammox Nitrospira in estuarine tidal flat wetland and the environmental drivers affecting their abundance and diversity remain unknown. Here, we present a large-scale investigation on the geographical distribution of comammox Nitrospira along the estuarine tidal flat wetlands of China, where comammox Nitrospira were successfully detected in 9 of the 16 sampling sites. The abundance of comammox Nitrospira ranged from 5.19 × 10 3 to 8.33 × 10 4 copies/g, 2.21 to 5.44-folds lower than canonical ammonia oxidizers: ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA). Phylogenetic analysis based on the alpha subunit of the ammonia monooxygenase encoding gene ( amoA ) revealed that comammox Nitrospira Clade A, mainly originating from upstream river inputs, accounts for more than 80% of the detected comammox Nitrospira , whereas comammox Nitrospira clade B were rarely detected. Comammox Nitrospira abundance and dominant comammox Nitrospira OTUs varied within the estuarine samples, showing a geographical pattern. Salinity and pH were the most important environmental drivers affecting the distribution of comammox Nitrospira in estuarine tidal flat wetlands. The abundance of comammox Nitrospira was further negatively correlated with high ammonia and nitrite concentrations. Altogether, this study revealed the existence, abundance and distribution of comammox Nitrospira and the driving environmental factors in estuarine ecosystems, thus providing insights into the ecological niches of this recently discovered nitrifying consortium and their contributions to nitrification in global estuarine environments.

show abstract

Section: Methodsmentioning

confidence: 99%

Distribution and Diversity of Comammox Nitrospira in Coastal Wetlands of China

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…Gao et al 44 also found that AOA community diversity increased as soil salinity increased, while AOB community diversity was highest in moderate or lower salinity soils. Alternatively, AOA communities can be adapted to low pH and low nutrient soil conditions 34,[45][46][47] , while AOB are thought to preferentially inhabit soil with neutral pH and high-N agricultural soils 10,44 . Following these observations, Schauss et al 48 speculated that AOB mainly dominate "nutrient-rich" environments, while AOA are better adapted to "nutrient-poor" environments.…”

Section: Discussionmentioning

confidence: 92%

Response of ammonia-oxidizing Bacteria and Archaea to long-term saline water irrigation in alluvial grey desert soils

Guo

Liang

et al. 2020

Sci Rep

View full text Add to dashboard Cite

Soil nitrification via ammonia oxidation is a key ecosystem process in terrestrial environments, but little is known of how increasing irrigation of farmland soils with saline waters effects these processes. We investigated the effects of long-term irrigation with saline water on the abundances and community structures of ammonia-oxidizing bacteria (AOB) and archaea (AOA). Irrigation with brackish or saline water increased soil salinity (EC 1:5 ) and NH 4 -n compared to irrigation with freshwater, while no 3 -n, potential nitrification rates (PNR) and amoA gene copy numbers of AOA and AOB decreased markedly under irrigation regimes with saline waters. Moreover, irrigation with brackish water lowered AOA/ AOB ratios. PNR was positively correlated with AOA and AOB amoA gene copy numbers across treatments. Saline and brackish water irrigation significantly increased the diversity of AOA, as noted by Shannon index values, while saline water irrigation markedly reduced AOB diversity. In addition, irrigation with brackish or fresh waters resulted in higher proportions of unclassified taxa in the AOB communities. However, irrigation with saline water led to higher proportions of unclassified taxa in the AoA communities along with the Candidatus Nitrosocaldus genus, as compared to soils irrigated with freshwater. AOA community structures were closely associated with soil salinity, NO 3 − n, and pH, while AOB communities were only significantly associated with NO 3 − N and pH. These results suggest that salinity was the dominant factor affecting the growth of ammonia-oxidizing microorganisms and community structure. These results can provide a scientific basis for further exploring the response mechanism of ammonia-oxidizing microorganisms and their roles in nitrogen transformation in alluvial grey desert soils of arid areas.index showed a significant (P < 0.001) opposite relationship. In addition, the SW treatment soils had a significantly lower AOB Shannon index (P = 0.002) compared to the FW soils, but a significantly higher Simpson index value (P = 0.003). The BW treatment did not have a significant effect on AOB diversity index. Scientific RepoRtS | (2020) 10:489 | https://doi.Scientific RepoRtS | (2020) 10:489 | https://doi.org/10.1038/s41598-019-57402-xwww.nature.com/scientificreports www.nature.com/scientificreports/ Nitrosomonadaceae and Nitrosopumilaceae were the two most dominant families in the dataset. The relative abundances of Nitrosomonadaceae were significantly greater in the FW treatment soils than in those of the BW and SW treatments (P < 0.001). However, no significant differences were observed for the relative abundances of Nitrosopumilaceae among the FW, BW, and SW treatment soils. Nitrosopumilus and Nitrosospira were the two most dominant genera in the sequencing datasets. The relative abundances of Nitrosospira were significantly higher in the FW treatment soils than in those of the BW and SW treatments (P < 0.001). However, no significant differences were observed for the relative abundances of Ni...

show abstract

“…All q-PCRs were performed in triplicate with an ABI 7500 Detection System (Applied Biosystems, Canada) using the SYBR Green method. The primers Arch-amoAF (STAATGGTCTGGCTTAGACG) and Arch-amoAR (GCGGCCATCCATCTGTATGT) were used to quantify the abundance of the AOA amoA gene (Gao et al, 2018), the primers amoA-1F (GGGGTTTCTACTGGTGGT) and amoA-2R (CCCCTCKGSAAAGCCTTCTTC) were used to quantify the abundance of the AOB amoA gene (Rotthauwe et al, 1997), the primers F1aCu (ATCATGGTSCTGCCGCG) and R3Cu (GCCTCGATCAGRTTGTGGTT) were used to quantify the abundance of the nirK gene (Hallin and Lindgren, 1999) and the primers cd3aF(GTSAACGTSAAGGARACSGG) and R3cd (GASTTCGGRTGSGTCTTGA) were used to quantify the abundance of the nirS gene (Throbäck et al, 2004). Details regarding the q-PCR conditions for these genes are provided in Table S1.…”

Section: Dna Isolation and Quantitative Pcrmentioning

confidence: 99%

The Nitrogen Removal Ability of Salt Marsh Improved After Grazing Prohibition

Niu

Nie

et al. 2022

Front. Mar. Sci.

View full text Add to dashboard Cite

Grazing prohibition has been used for some conservation purposes in salt marshes. However, the impact of this measure on microbe-mediated key nitrogen removal processes remains poorly understood. Therefore, this study assessed the impact of grazing prohibition on potential rates of nitrification and denitrification under short- and long-term grazing prohibition in high and middle elevation of the Dongtan salt marsh on Chongming Island, China. Compared with short-term grazing prohibition, we found that long-term grazing prohibition significantly increased nitrification and denitrification (except for nitrification in the high marsh), which indicates that the nitrogen removal ability of the salt marsh was improved along with the grazing prohibition time. Furthermore, we found that nitrification and denitrification in the high marsh were largely affected by NH4+ and soil moisture, respectively. Nitrification and denitrification in the middle marsh were mainly controlled by soil organic carbon (SOC) and nirS gene abundances, respectively. Our results indicate that the implementation of scientific and reasonable grazing prohibition policies in salt marshes has great potential to restore their ecosystem functions, maintain their ecosystem balance and realize their sustainable development.

show abstract

Shifts in the Community Dynamics and Activity of Ammonia‐Oxidizing Prokaryotes Along the Yangtze Estuarine Salinity Gradient

Cited by 21 publications

References 69 publications

Distribution and Diversity of Comammox Nitrospira in Coastal Wetlands of China

Distribution and Diversity of Comammox Nitrospira in Coastal Wetlands of China

Response of ammonia-oxidizing Bacteria and Archaea to long-term saline water irrigation in alluvial grey desert soils

The Nitrogen Removal Ability of Salt Marsh Improved After Grazing Prohibition

Contact Info

Product

Resources

About