Shifting range in a stingless bee leads to pre-mating reproductive interference between species

Paul, Grace; Bartels, Louisa; Bueno, Francisco Garcia Bulle; Law, Genevieve; Heard, Tim A.; Chapman, Nadine C.; Buchmann, Gabriele; Lim, Julianne

doi:10.1007/s10592-023-01512-7

Cited by 1 publication

(1 citation statement)

References 48 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Bees were collected fresh on the day of each assay between 08.00 and 08.30 in which ambient temperatures were between 21°C and 24°C. Hives were selected based on confirmed identification of T. hockingsi via genetic analysis ( primers described in [71]) to amplify a 299 bp fragment of the mitochondrial gene cytochrome oxidase I (mt-COI) in T. hockingsi (sequences: Barhock_R: AAGGCCGAATCCTGGAAGAA and T_hock_COI_spec_F5: GAATTTCATCTATTCTTGGA) by Dr Ros Gloag, The University of Sydney. We collected exiting foragers by placing our experimental arenas (240 ml, 119 mm diameter × 38 mm height polypropylene containers) over the hive entrance.…”

Section: Field Collection and Laboratory Conditionsmentioning

confidence: 99%

Sublethal doses of insecticide reduce thermal tolerance of a stingless bee and are not avoided in a resource choice test

Farnan,

Yeeles,

Lach

2023

R. Soc. open sci.

View full text Add to dashboard Cite

Insecticides and climate change are among the multiple stressors that bees face, but little is known about their synergistic effects, especially for non- Apis bee species. In laboratory experiments, we tested whether the stingless bee Tetragonula hockingsi avoids insecticide in sucrose solutions and how T. hockingsi responds to insecticide and heat stress combined. We found that T. hockingsi neither preferred nor avoided sucrose solutions with either low (2.5 × 10 −4 ng µl −1 imidacloprid or 1.0 × 10 −4 ng µl −1 fipronil) or high (2.5 × 10 −3 ng µl −1 imidacloprid or 1.0 × 10 −3 ng µl −1 fipronil) insecticide concentrations when offered alongside sucrose without insecticide. In our combined stress experiment, the smallest dose of imidacloprid (7.5 × 10 −4 ng) did not significantly affect thermal tolerance (CT max ). However, CT max significantly reduced by 0.8°C (±0.16 SE) and by 0.5°C (±0.16 SE) when bees were fed as little as 7.5 × 10 −3 ng of imidacloprid or 3.0 × 10 −4 ng of fipronil, respectively, and as much as 1.5°C (±0.16 SE) and 1.2°C (±0.16 SE) when bees were fed 7.5 × 10 −2 ng of imidacloprid or 3.0 × 10 −2 ng of fipronil, respectively. Predictions of temperature increase, and increased insecticide use in the tropics suggest that T. hockingsi will be at increased risk of the effects of both stressors in the future.

show abstract

Section: Field Collection and Laboratory Conditionsmentioning

confidence: 99%