Shedding of N-acetylglucosaminyltransferase-V is regulated by maturity of cellular N-glycan

Abstract

The number of N-glycan branches on glycoproteins is closely related to the development and aggravation of various diseases. Dysregulated formation of the branch produced by N-acetylglucosaminyltransferase-V (GnT-V, also called as MGAT5) promotes cancer growth and malignancy. However, it is largely unknown how the activity of GnT-V in cells is regulated. Here, we discover that the activity of GnT-V in cells is selectively upregulated by changing cellular N-glycans from mature to immature forms. Our glycomic analysis further shows that loss of terminal modifications of N-glycans resulted in an increase in the amount of the GnT-V-produced branch. Mechanistically, shedding (cleavage and extracellular secretion) of GnT-V mediated by signal peptide peptidase-like 3 (SPPL3) protease is greatly inhibited by blocking maturation of cellular N-glycans, resulting in an increased level of GnT-V protein in cells. Alteration of cellular N-glycans hardly impairs expression or localization of SPPL3; instead, SPPL3-mediated shedding of GnT-V is shown to be regulated by N-glycans on GnT-V, suggesting that the level of GnT-V cleavage is regulated by its own N-glycan structures. These findings shed light on a mechanism of secretion-based regulation of GnT-V activity.

Upregulation of GALNT7 in prostate cancer modifies O-glycosylation and promotes tumour growth

“…We noted that the localisation of both proteins in prostate cancer tissue was similar, which was unexpected because GALNT7 is a Golgi-resident enzyme in healthy cells while PSA is secreted into blood. Based on this, and because shedding of glycosylatransferases has been previously reported (27)(28)(29)(30), we hypothesised that like PSA, GALNT7 may also be secreted into the urine and blood of men with prostate cancer. Using pre-validated sandwich ELISA assays (Supplementary Fig.…”

N-acetylglucosaminyltransferase-V (GnT-V)-enriched small extracellular vesicles mediate N-glycan remodeling in recipient cells

“…Instead, as GnT-V is proteolytically cleaved by SPPL3, 39 we hypothesized that GnT-V in sEVs is a cleaved short form (hereafter designated as “sGnT-V″) produced by SPPL3. To examine this, we knocked out SPPL3 in B16 cells 54 and investigated the protein level and activity of GnT-V in sEVs derived from SPPL3-KO cells. The protein level and activity of GnT-V were increased in KO cells ( Figure 2 B, first and second lanes, and Figure 2 C, left).…”

“… 58 N/A B16-hGnT-V-Halo7 Hirata et al. 54 N/A B16-CD81-Halo This study N/A B16-Halo in-CD81 This study N/A B16-hGnT-V-Halo7-CD81-EGFP This study N/A Oligonucleotides Primers for constructing all of the plasmids, see Table S1 This study N/A Recombinant DNA pcDNA6/myc-His A-hGnT-V-Halo7 Hirata et al. 54 N/A pEGFPN1/CD81-Halo7 This study N/A pcDNA6/CD81-EGFP This study N/A pcDNA6/CD63-EGFP This study N/A pcDNA6/Halo in-CD81 This study N/A pX330-Puro-mMGAT5#1 This study N/A pX330-Puro-mMGAT5#1 This study N/A Software and algorithms Izon Control Suite 3.3.2.2001 Izon https://support.izon.com/qnano-control-suite-software FlowJo 10.7.1 BD Biosciences https://www.flowjo.com GraphPad Prism 8 software GraphPad Software, Inc. https://www.graphpad.com …”

“…B16 expressing hGnT-V-Halo7, B16-SPPL3-KO (clone #1), and HeLa-GnT-V-KO (clone #11) cells were established previously. 54 , 58 Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum and 50 μg/mL kanamycin at 37°C under 5% v/v CO 2 . Stable transfectants expressing GnT-V-Halo and Halo in-CD81 were maintained in DMEM supplemented with 10% fetal bovine serum, 50 μg/mL kanamycin, and 8 μg/mL blasticidin and cells stably expressing CD81-Halo were maintained in DMEM supplemented with 10% fetal bovine serum, 50 μg/mL kanamycin, and 800 μg/mL G418 under the same conditions.…”

“…pcDNA6-myc-His A/hGnT-V-Halo7 was constructed previously. 54 To construct pEGFP-N1/CD81-Halo7, pEGFP-N1 vector containing Halo7-tag sequence was amplified by PCR using primers (F: ACCGGTGGTGGGCGCGCC and R: GAATTCAGATCCGGTACCGC) from pEGFP-N1/CD63-Halo7 and CD81 sequence was amplified by PCR using primers (F: gcggtaccggatctgaattcATGGGAGTGGAGGGCTGC and R: gaggcgcgcccaccaccggtGTACACGGAGCTGTTCCG) from pFN21AE5228 plasmid purchased from Kazusa Genome Technologies (product ID: FHC08124). The amplified sequences were ligated with NEBuilder HiFi DNA Assembly Master Mix, in accordance with the manufacturer’s protocol.…”