SH2 Domain-Containing Phosphatase-2 Protein-Tyrosine Phosphatase Promotes FcεRI-Induced Activation of Fyn and Erk Pathways Leading to TNFα Release from Bone Marrow-Derived Mast Cells

Abstract

Clustering of the high affinity IgE receptor (FcεRI) in mast cells leads to degranulation and production of numerous cytokines and lipid mediators that promote allergic inflammation. Initiation of FcεRI signaling involves rapid tyrosine phosphorylation of FcεRI and membrane-localized adaptor proteins that recruit additional SH2 domain-containing proteins that dynamically regulate downstream signaling. SH2 domain-containing phosphatase-2 (SHP2) is a protein-tyrosine phosphatase implicated in FcεRI signaling, but whose function is not well defined. In this study, using a mouse model allowing temporal shp2 inactivation in bone marrow-derived mast cells (BMMCs), we provide insights into SHP2 functions in the FcεRI pathway. Although no overt defects in FcεRI-induced tyrosine phosphorylation were observed in SHP2 knock-out (KO) BMMCs, several proteins including Lyn and Syk kinases displayed extended phosphorylation kinetics compared with wild-type BMMCs. SHP2 was dispensable for FcεRI-induced degranulation of BMMCs, but was required for maximal activation of Erk and Jnk mitogen-activated protein kinases. SHP2 KO BMMCs displayed several phenotypes associated with reduced Fyn activity, including elevated phosphorylation of the inhibitory pY531 site in Fyn, impaired signaling to Grb2-associated binder 2, Akt/PKB, and IκB kinase, and decreased TNF-α release compared with control cells. This is likely due to elevated Lyn activity in SHP2 KO BMMCs, and the ability of Lyn to antagonize Fyn activity. Overall, our study identifies SHP2 as a positive effector of FcεRI-induced activation of Fyn/Grb2-associated binder 2/Akt and Ras/Erk pathways leading to TNF-α release from mast cells.

SH2 Domain-Containing Phosphatase 2 Is a Critical Regulator of Connective Tissue Mast Cell Survival and Homeostasis in Mice

“…To better characterize the phenotype of SHP2-deficient mast cells, we used 4TM treatment to induce shp2 deletion (KO) in BMMCs from Tg CreER :shp2 fl/fl mice and compared to them to 4TM-treated control BMMCs from shp2 fl/fl mice (WT). As we reported previously (31), no defects in KIT or FcεRI expression levels were observed in shp2 KO BMMCs (data not shown). In these cultures, shp2 KO BMMCs display almost complete conversion of shp2 flox alleles to null alleles upon 4TM treatment (Fig.…”

“…The genotyping of shp2 flox and null alleles was described previously (31,49). For enhanced detection of the shp2 null allele, nested PCR was performed using shp2 null primers for 15 cycles (49), followed by 30 cycles with the following nested shp2 primers: 5=TTCACTAAATGCAACAACTGGC3= (forward) and 5=GGACAGG TACTAGGCTCCATCCC3= (reverse).…”

“…Thus, SHP2 promotes the survival of BMMCs in vitro and is critical for CTMC homeostasis in vivo. and Tg CreER :shp2 ϩ/ϩ mice on a C57BL/6 background was described previously (31). Mast cell-deficient Kit W-sh/W-sh mice on a C57BL/6 background were obtained from The Jackson Laboratory.…”

PTPα Activates Lyn and Fyn and Suppresses Hck to Negatively Regulate FcεRI-Dependent Mast Cell Activation and Allergic Responses

“…Thus, defective CD45-mediated regulation of Lyn is a primary event underlying defective FcεRI-mediated responses. BMMCs lacking the nonreceptor PTP SHP-2 exhibit enhanced Ag-induced Lyn activity accompanied by decreased Fyn activation and Fyn-dependent signaling (23). Overall, the lack of SHP-2 did not affect degranulation, but it enhances TNF-a release.…”

Role of SHP2 phosphatase in KIT-induced transformation: identification of SHP2 as a druggable target in diseases involving oncogenic KIT

“…SHP2 flox/flox mice were crossed with Tg CreER transgenic mice to generate congenic littermates that were of the genotype, SHP2 flox/flox (control) or SHP2 flox/flox : Tg CreER . 21 Gab2 Ϫ/Ϫ mice and mast cell-deficient Kit W-sh/W-sh mice were previously described. 22,23 All mice used in this study were between 6 and 12 weeks of age.…”