Sexual dimorphism and androgen regulation of satellite cell population in differentiating rat levator ani muscle

Abstract

The bulbocavernosus (BC) and levator ani (LA) muscles of rats show remarkable androgen-dependent sexual dimorphism. These muscles are additionally of interest because they are thought to indirectly mediate sexual differentiation of innervating spinal motoneurons. This sexual differentiation of the BC/LA is thought to be due to an increase in muscle units in the male rat during the first week after birth. We examined the cellular basis of this differentiation by studying satellite cells in the LA of postnatal day 2.5 rats, when sexual dimorphism is already prominent. Two experiments were performed in which LA satellite cells were measured: (1) wild-type (WT) males were compared with females and to Tfm androgen receptor mutant males, which are androgen insensitive despite producing masculine amounts of testosterone, and (2) females treated prenatally and/or postnatally with testosterone proprionate were compared with females receiving vehicle injections. Our results indicate that WT males have a larger LA and a greater number of satellite cells in the LA muscle than females or Tfm males. However, satellite cell density was similar for all three groups. Prenatal testosterone treatment masculinized LA size and resulted in a corresponding increase in satellite cell populations, while postnatal TP treatment resulted in a tendency for increased satellite cell density without a significant increase in LA size. Taken together, these studies indicate that satellite cells in the neonatal LA muscle are sexually dimorphic, and that this dimorphism likely results from perinatal actions of androgens on androgen receptors.

Sexual Differentiation of the Spinal Nucleus of the Bulbocavernosus Is Not Mediated Solely by Androgen Receptors in Muscle Fibers

“…Whereas AR expression in fibroblasts and adipocytes has not been examined in the developing LA muscle, Jordan et al (14) reported AR immunoreactivity in satellite cells. Furthermore, Niel et al (21) demonstrated an androgen-dependent sexual dimorphism in satellite cell number in the developing LA, suggesting that they are another potential site for AR action. In addition to a number of different cell types within the BC/LA muscles, there are various other tissues in the perineal region containing adipocytes, endothelial cells, epithelial cells, and Schwann cells, and the possibility of direct androgen action on AR in these tissues during the perinatal period has not yet been explored.…”

“…For experiment 1c, LA volume was examined on PND 2.5 for WT males (n ϭ 4), WT females (n ϭ 5), and Tfm males with and without the HSA-AR transgene (n ϭ 6 per group) after perinatal treatment with TP as described by Niel et al (21). Perineal blocks were dissected fresh and frozen in isopentane cooled by dry ice, then stored at Ϫ80 C until histological processing.…”

“…Pups were treated perinatally with testosterone propionate (TP) as described in Niel et al (21). Limbs were dissected fresh at PND 2.5, frozen in liquid nitrogen, and then stored at Ϫ80 C until histological processing.…”

“…Tfm genotyping was performed using ear or tail samples essentially as previously described (21). For HSA-AR genotyping, primers (forward) ATGGGAAGCTGGTCATCAAC and (reverse) GGATGCAGG-GATGATGTTCT were used to amplify the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase with a 440-bp product, and primers (forward) GGACAGGGCACTACCGAG and (reverse) GGCT-GAATCTTCCACCTAC were used to detect the HSA-AR transgene with a 192-bp product.…”

Cellular and molecular mechanisms of sexual differentiation in the mammalian nervous system

“…To test whether androgen action at myocytes could solely explain effects on SNB cell survival, Niel and colleagues generated rats expressing functional androgen receptors only in myocytes, and inactive, mutant receptors in all other cells throughout the body (Niel et al, 2008). SNB motoneuron number and target muscle size was female-like in these animals, even after perinatal exposure to androgens (Figure 3; Niel et al, 2008). This suggests that androgen action at muscle fibers alone is not sufficient for rescue of the SNB neuromuscular system.…”