Sex-related differences in pulmonary physiologic outcome measures in a high-risk birth cohort

Jackson, Daniel J.; Evans, Michael D.; Rajamanickam, Victoria; Gangnon, Ronald E.; Fain, Sean B.; Sorkness, Ronald L.; Okupa, Adesua Y.; Thomas, Alex; Gern, James E.; Lemanske, Robert F.

doi:10.1016/j.jaci.2014.12.1927

Cited by 7 publications

(5 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The prevalence of BHR has been reported variously from 10.6% to 78.2%, which was affected by subject age, population characteristics, provocation method and cutoff. 3 4 5 6 7 8 9 10 BHR is associated with later asthma development in asymptomatic subjects, 11 and its persistence is associated with allergic sensitization, a family history of allergic diseases and the asthma severity at diagnosis. 12 13 14 In Korea, BHR had been assessed with methacholine.…”

Section: Introductionmentioning

confidence: 99%

Prevalence, Risk Factors and Cutoff Values for Bronchial Hyperresponsiveness to Provocholine in 7-Year-Old Children

Jung

Suh

Lee

et al. 2018

Allergy Asthma Immunol Res

View full text Add to dashboard Cite

BackgroundA US Food and Drug Administration (FDA)-approved drug methacholine chloride (Provocholine®) was recently introduced to Korea where it is now widely used in clinical practice. We aimed to evaluate the prevalence, risk factors and cutoff value of bronchial hyperresponsiveness (BHR) to Provocholine in 7-year-old children.MethodsSix hundred and thirty-three children from the Panel Study on Korean Children who visited 16 regional hospitals were evaluated. Skin prick tests, spirometry and bronchial provocation tests for Provocholine as well as a detailed history and physical examinations were performed. The bronchial provocation test was reliably performed on 559 of these children.ResultsThe prevalence of ever-diagnosed asthma via medical records was 7.7%, and that of current asthma (wheezy episode in the last 12 months + diagnosed asthma by physicians) was 3.2%. The prevalence of BHR to Provocholine was 17.2% and 25.8%, respectively, for a PC20 < 8 and < 16 mg/mL. The risk factors for BHR (PC20 < 16 mg/mL) were atopic dermatitis diagnosis and current dog ownership, whereas those for current asthma were allergy rhinitis diagnosis, a history of bronchiolitis before the age of 3, recent use of analgesics/antipyretics and maternal history of asthma. The BHR prevalence trend showed an increase along with the increased immunoglobulin E (IgE) quartile. The cutoff value of PC20 for the diagnosis of current asthma in children at age 7 was 5.8 mg/mL (sensitivity: 47.1%, specificity: 87.4%).ConclusionsBHR to Provocholine (PC20 < 8 mg/mL) was observed in 17.2% of 7-year-olds children from the general population and the cutoff value of PC20 for the diagnosis of current asthma was 5.8 mg/mL in this age group. The risk factors for BHR and current asthma showed discrepancies suggesting different underlying mechanisms. Bronchial provocation testing with Provocholine will be a useful clinical tool in the future.

show abstract

Section: Introductionmentioning

confidence: 99%

Prevalence, Risk Factors and Cutoff Values for Bronchial Hyperresponsiveness to Provocholine in 7-Year-Old Children

Jung

Suh

Lee

et al. 2018

Allergy Asthma Immunol Res

View full text Add to dashboard Cite

show abstract

“…This could be related to males being more likely to perform an incorrectly test preparation or to present a slow transit or a bacterial overgrowth. The last result might also refer to a difference in dynamics in pulmonary ventilation rather than a real difference in intestinal fermentation, as some studies suggest that pulmonary parameters differ according to gender in children [ 24 ].…”

Section: Resultsmentioning

confidence: 99%

Data Mining Techniques Applied to Hydrogen Lactose Breath Test

et al. 2017

View full text Add to dashboard Cite

In this work, we present the results of applying data mining techniques to hydrogen breath test data. Disposal of H2 gas is of utmost relevance to maintain efficient microbial fermentation processes.ObjectivesAnalyze a set of data of hydrogen breath tests by use of data mining tools. Identify new patterns of H2 production.MethodsHydrogen breath tests data sets as well as k-means clustering as the data mining technique to a dataset of 2571 patients.ResultsSix different patterns have been extracted upon analysis of the hydrogen breath test data. We have also shown the relevance of each of the samples taken throughout the test.ConclusionsAnalysis of the hydrogen breath test data sets using data mining techniques has identified new patterns of hydrogen generation upon lactose absorption. We can see the potential of application of data mining techniques to clinical data sets. These results offer promising data for future research on the relations between gut microbiota produced hydrogen and its link to clinical symptoms.

show abstract

“…TYK2 mRNA levels were measured in whole blood of healthy donors from the Milieu Intérieur cohort by the NanoString hybridization-based multiplex assay [28]. The Milieu Intérieur cohort is composed of 500 men and 500 women from 20 to 69 years of age [67, 68]. The NanoString TYK2 probe is complementary to the exon 3/exon 4 junction: GGGCCTGAGCATCGAAGAGGGCAAAGAGATTGAAGCAAGGAGGAGTGATACCA ACTTTATGTGCAATGTGGATGCAGACTTCCTCAGCTGTCAGCGATGA.…”

Section: Methodsmentioning

confidence: 99%

Two common disease-associated TYK2 variants impact exon splicing and TYK2 dosage

Rotival

Patin

et al. 2019

Preprint

View full text Add to dashboard Cite

23 TYK2 belongs to the JAK protein tyrosine kinase family and mediates signaling of numerous 24 antiviral and immunoregulatory cytokines (type I and type III IFNs, IL-10, IL-12, IL-22, IL-25 23) in immune and non-immune cells. After many years of genetic association studies, TYK2 26 is recognized as a susceptibility gene for some inflammatory and autoimmune diseases (AID).27 Seven TYK2 variants have been associated with AIDs in Europeans, and establishing their 28 causality remains challenging. Previous work showed that a protective variant (P1104A) is 29 hypomorphic and also a risk allele for mycobacterial infection. Here, we have studied two 30 AID-associated common TYK2 variants: rs12720270 located in intron 7 and rs2304256, a 31 non-synonymous variant in exon 8 that causes a valine to phenylalanine substitution (c.1084 32 G > T, Val362Phe). We found that this amino acid substitution does not alter TYK2 33 expression, catalytic activity or ability to relay signaling in EBV-B cell lines or in 34 reconstituted TYK2-null cells. Based on in silico predictions that these variants may impact 35 splicing of exon 8, we: i) analyzed TYK2 transcripts in genotyped EBV-B cells and in 36 CRISPR/Cas9-edited cells, ii) measured splicing using minigene assays, and iii) performed 37 eQTL (expression quantitative trait locus) analysis of TYK2 transcripts in primary monocytes 38 and whole blood cells. Our results reveal that the two variants promote the inclusion of exon 39 8, which, we demonstrate, is essential for TYK2 binding to cognate receptors. In addition and 40 in line with GTEx (Genetic Tissue Expression) data, our eQTL results show that rs2304256 41 mildly enhances TYK2 expression in whole blood. In all, these findings suggest that these 42 TYK2 variants are not neutral but instead have a potential impact in AID. 3 43 Introduction 44 Early genetic association studies have assigned to the TYK2 locus an impact on susceptibility 45 to systemic lupus erythematosus (SLE) and other autoimmune diseases (AID). The 46 identification has been replicated in a number of recent analyses, and TYK2 is now recognized 47 as a susceptibility gene in a variety of inflammatory and autoimmune diseases, including type 48 I diabetes (T1D), psoriasis and multiple sclerosis (Table 1). These chronic disorders have a 49 complex etiology where combinations of genetic and environmental factors eventually lead to 50 loss of immunological tolerance, chronic immune activation, and damage to one organ or 51 several tissues [1]. 52How TYK2 variants impact disease onset or progression remains an open question. In 53 human populations, the TYK2 locus presents with thousands of single nucleotide 54 polymorphisms (SNP), of which more than 500 cause non-synonymous (amino acid-altering) 55 changes. Seven TYK2 variants have been associated with AIDs in European cohorts and for 56 most the minor allele is protective (Table 1). Notably, rs12720356 (I684S) is protective for 57 some AID but risky for others, which suggests different underlying pathogenic mechanis...

show abstract

Sex-related differences in pulmonary physiologic outcome measures in a high-risk birth cohort

Cited by 7 publications

References 21 publications

Prevalence, Risk Factors and Cutoff Values for Bronchial Hyperresponsiveness to Provocholine in 7-Year-Old Children

Prevalence, Risk Factors and Cutoff Values for Bronchial Hyperresponsiveness to Provocholine in 7-Year-Old Children

Data Mining Techniques Applied to Hydrogen Lactose Breath Test

Two common disease-associated TYK2 variants impact exon splicing and TYK2 dosage

Contact Info

Product

Resources

About