Sex chromosome evolution in snakes inferred from divergence patterns of two gametologous genes and chromosome distribution of sex chromosome-linked repetitive sequences

Abstract

BackgroundThe discovery of differentially organized sex chromosome systems suggests that heteromorphic sex chromosomes evolved from a pair of homologous chromosomes. Whereas karyotypes are highly conserved in alethinophidian snakes, the degeneration status of the W chromosomes varies among species. The Z and W chromosomes are morphologically homomorphic in henophidian species, whereas in snakes belonging to caenophidian families the W chromosomes are highly degenerated. Snakes therefore are excellent animal models in which to study sex chromosome evolution. Herein, we investigated the differentiation processes for snake sex chromosomes using both coding and repetitive sequences. We analyzed phylogenetic relationships of CTNNB1 and WAC genes, localized to the centromeric and telomeric regions, respectively, of the long arms on snake sex chromosomes, and chromosome distribution of sex chromosome-linked repetitive sequences in several henophidian and caenophidian species.ResultsPartial or full-length coding sequences of CTNNB1 and WAC were identified for Z homologs of henophidian species from Tropidophiidae, Boidae, Cylindrophiidae, Xenopeltidae, and Pythonidae, and for Z and W homologs of caenophidian species from Acrochordidae, Viperidae, Elapidae, and Colubridae. Female-specific sequences for the two genes were not found in the henophidian (boid and pythonid) species examined. Phylogenetic trees constructed using each gene showed that the Z and W homologs of the caenophidian species cluster separately. The repetitive sequence isolated from the W chromosome heterochromatin of the colubrid Elaphe quadrivirgata and a microsatellite motif (AGAT)8 were strongly hybridized with W chromosomes of the viperid and colubrid species examined.ConclusionOur phylogenetic analyses suggest that the cessation of recombination between the Z and W homologs of CTNNB1 and WAC predated the diversification of the caenophidian families. As the repetitive sequences on the W chromosomes were shared among viperid and colubrid species, heterochromatinization of the proto-W chromosome appears to have occurred before the splitting of these two groups. These results collectively suggest that differentiation of the proto-Z and proto-W chromosomes extended to wide regions on the sex chromosomes in the common ancestor of caenophidian families during a relatively short period.Electronic supplementary materialThe online version of this article (doi:10.1186/s40851-016-0056-1) contains supplementary material, which is available to authorized users.

Karyotype Analysis of Four Blind Snake Species (Reptilia: Squamata: Scolecophidia) and Karyotypic Changes in Serpentes

“…The karyotypes of 3 diploid scolecophidian species, X. vermicularis , L. simonii , and M. macrorhyncha , had 8 pairs of macrochromosomes, just as the standard karyotype of alethinophidian species [Beçak et al, 1962[Beçak et al, , 1964Beçak and Beçak, 1969;Singh, 1972;Ota, 1999;Olmo and Signorino, 2005;Matsubara et al, 2006Matsubara et al, , 2015bMatsubara et al, , 2016a. On the contrary, the numbers of microchromosomes in these scolecophidian species were fewer than those in the standard alethinophidian karyotype.…”

“…For Cbanding analyses, chromosome slides were prepared from fibroblasts cultured without BrdU treatment and stained using the CBG (C-bands by barium hydroxide using Giemsa) method [Sumner, 1972]. Chromosome slides from 6 alethinophidians, E. quadrivir-gata (Colubridae), Rhabdophis tigrinus (Colubridae), Python bivittatus (Pythonidae), Boa constrictor (Boidae), Protobothrops flavoviridis (Viperidae), and Bitis arietans (Viperidae) were prepared in our previous studies [Matsuda et al, 2005;Matsubara et al, 2006Matsubara et al, , 2015bMatsubara et al, , 2016a.…”

“…The karyotypes are highly conserved in the Alethinophidia, and the common chromosome number is 2n = 36, comprising 8 pairs of macrochromosomes and 10 pairs of microchromosomes [Beçak et al, 1962[Beçak et al, , 1964Beçak and Beçak, 1969;Singh, 1972;Ota, 1999;Matsubara et al, 2006Matsubara et al, , 2015bMatsubara et al, , 2016a. This karyotype is not limited to a few particular lineages but prevails in almost all alethinophidian families [Olmo and Signorino, 2005] except for 2 small colubroid families, Xenodermatidae and Achrocordidae [Ota et al, 1991a;Rovatsos et al, 2015aRovatsos et al, , 2018; thus, the common ancestor of Alethinophidia probably had this karyotype.…”

A novel method of caenophidian snake sex identification using molecular markers based on two gametologous genes

“…For WAC genes, partial DNA fragments of exons 9–10 were amplified using target‐specific primers Eq‐WAC‐int9‐F: 5′‐CTCAGCCATCTAATCAGTCCCCAA‐3′ and Eq‐WAC‐int9‐R: 5′‐GAACGCTGAAGACTTCGAGGAG‐3′ (Matsubara et al., ). For the CTNNB1 gene, partial DNA fragments were amplified using PCR primers (Eq‐CTNNB1‐11‐F1: 5′‐AGAGACGTCCACAATCGGATTG‐3′ and Eq‐CTNNB1‐13‐R: 5′‐CAGACGTTTCTTATAATCTTGTGG‐3′) (Laopichienpong et al., ; Matsubara et al., ). The female‐specific PCR products with different size from the DNA fragments commonly found for both males and females ( WACZ and CTNNB1Z ) were expected to derive from the genes WACW and CTNNB1W (File S1).…”

“…Z sex chromosomes which have homology with chicken chromosomes 2 and 27 is the fourth or fifth largest metacentric chromosome in the karyotypes of most snake species (Matsubara et al., , ; Rovatsos, Vukić, Lymberakis, & Kratochvíl, ; Vicoso, Emerson, Zektser, Mahajan, & Bachtrog, ). Recently, sequence analysis of two gametologous genes as the catenin (cadherin‐associated protein) beta 1 ( CTNNB1 ) and the WW domain containing adaptor with coiled‐coil ( WAC ) has provided information on the evolutionary process of sex chromosome differentiation in snakes (Laopichienpong et al., ; Matsubara, Nishida, Matsuda, & Kumazawa, ; Matsubara et al., ). Size and sequence differences between the Z and W homologs of these genes were found in many caenophidian snakes, leading us to develop molecular sexing markers to identify male and female individuals.…”